Description :
From Genome Similarity Track
Location :
Scaffold_64:196472- 200898
Transcript NameFunction/comments
Phyci_9649Hypothetical protein
Phyci_29385pantothenate kinase, putative
Phyci_230395hypothetical protein PGUG_00028

Sequence
4426 bases(100 bases per row)
GGGGCGATTACGGCAGGAAGGGAGGCCTCGCAGGCGATAAATTACTTAGTTGGCTATCGTATCGAGCGCTCGCCGAGGGCGGTAGGTGTCCGTAATCACC
CGCTGCCAGGAAGGCAGAGCGCCCGCGTCTATTTTGTGGGCGGGGTCTACATGACCCGCTGGCGCTTGAGGGGCCCACCGCACGAGAGCGAGGGCGCGGC
CTGGTACTTGGTCCACCGGCGGGCCAGAATGGCCTCCTCCTGCTTCCGGCGGATGTAGCTGCTGTGTGCCGGCAGGTTGGCCACTGCAAGGCGTTTGGGC
GCGGCGGGCGCAGCGGTGCACTCGACGAACAAGCTCGGGTCCAGCTCGTTCAGGTACTCGTCGAGGCTGCGGATGAGCACGCGCTCGGTCGgctgttgtt
gctgctgctgctgctgctgctgctCGAGCTGGTGCTTGCGCTCGAGGAAGTCCTGGATCTCCTCGTACTGGCTGCGCGAGCGACTGTCGTGCACGCCGAG
CAGCAGAGTGGAGGCCTCGTCGAGGCCGCCCACCTGCGCGCAGATGTAGCGCTGCACGTGGTCCATCTCGGCGCGGTACTGCTGCTCCTTGGCGGGCGAC
GCGAACTGCAGCGGGCGCCGCACCACACGGCGCAGTGGCGGCTGCGGCTTGCTGCTGCTGCTGGGCATCATGGGCTTTCGGGGCGGACGGCGAATGCTGG
AATGACACCGAAGCTGCTGCGGCCGGCACCGAGCGAGGTCCAACGGCGGCTGTTACAGCCGCTTCAAGCACTGCGGGCGCCCATCACGCGACGCGACGAC
GCGCGTGACATCTAGGTATCAATCAGGGCGGGCTGGATTTCTTTTTTACTGACCTACACCTGAAACATAAAGGTCTGCTGCTGCAGTGGGTGTATCGAAC
CTGTAGAAACAGATAGGGATGTGGTATAGAGGGTATGTGGTGTAGCGGGTTCGGGGCACTGTCATCTGGTTCTAAAAAATCGGGAAAAACAAGTCGACTT
TTGCTCGAAAGCGCCATGGAGACATCTTGCCAGCGCTTTGCCCCGATTTGCCCTGAGACGCCGGGGCTGGATTATTATCGCGCCGCACGGAACTCGCGTC
GATAGAGGCGGGATTTTGTTGCCGCCACGCCGGTGGTCGAGGTGATCACTACCTCGCGCTGTCCGCCGACGGGCCGACGCTGTGGATTCACTCTGCACGA
GCCGCAGATCGGATCGGGGCGCAGTGCTGCTGCCCGTGTGACTTCGGTCCAAGTCGCTCCGAGTCGAATGTCAGATGGCTGCCCCGCCTCGGCTCACCTG
CCGGCTGGCTGATTATTATTGACGCGCACAGGCCGTTGGCGAGAGAAATCCGCCCAGGGTTGATTCCTGGCAAGCGAACGATATGAACCTTCGGTGCAGT
AGCCACTTGCAGCTACATTCATGTACTATATGAAGCGAAGATCACAGGCAGCGGATACCAGAAAGACTCGACTAGCTAACGCCATTAGCTACAGGCCCCG
CCACTGTAGCTACACAGCAGCGGGGCCGAGCTGGTCTGGTCCTGTCATCGGGATCGGCCACGCACGTCACTGGTCAAAAGCGTCCCCCATTTCGCCCAAT
CACCCGTCGCATACGTCGACGTGGGGTTCCGCAAAGTTCAATCAAGCATCACCCACCCACCCACGCTCGCTCCATGGCTGTGGCTGTGGCGGACGGCGCC
GAGCGCGCGCTGCTGGCTGGCGGCTTCCTGCTCTTCTCGTCGTCCGTGGCGCTCTTCTGCCTGGAGCGCAAGCGCCACCGCCAGCGCGTGTGGCGCCAGC
GCCTCACCTACAAGAAGCTCTCCAAATCGTATTCTACACTATAATTTAATTAATTAGCCAGTATAATAACACTAATTAAATAAGGATATTAACCCCCGCT
GGTGGCCTGCTGCAGATCAGACCTGGGCGCGTCCTTCGGGCTGGACATCGGTGCGTCGCGGACGGGAAAAATCCATCGCTAGGCCTTCTGACTCATGAgc
tgtgctgtgctgtgctgtgctgtgctgtgctgtgctgtgctgtgctgtgctgtgTGCTGTGGTAGGGGGTACGCTGGCCAAGATCGTGTACTTCGAGCGC
CACGACGCGGCCTCCGACACGCGCAAGCGGCCGCGCTCGGCGTCGCTGGACGTGGCGGCGGGCGAGATGAACAAGTTCCTGCGCGAGAACCAGTCCTTCG
GCAGCACGGGCGTGCAGGACGTGCGGCTGAGAATCCACTCCAAGACGCTCAACGGGGTGGGCGCTGCAGCTGCGGCTGCTGCTGTGGGTTGACCACGGAC
TCACCAGTGTTGCTGTGTATCCTTCTGGTTGCAGATCTTCCACTTCGTCCGGTTCGAGAGCAGCAAGACGCGCGAGGCGATCGAGTTCATCGCGGTAAAT
GGGATCAACCAGTCCCTCCGGATCCTGCCCTGCACGGGCGGCGGCGCCCACAAGGTTCGTGCTGCTGGGTGAGTGGAGTGCCGGTGGAGAGAGGTGCTGA
CCTTGTTGTGATGTTCTGCGAGTAGTATGGACACGCTTTCAACGAGATTGCTGGGGTTGAGCTGGAGAAGTACGACGAGATTGAGTGCACCATTTTGGGC
CTGCACCTGCTGCTCACGACGCTGTCCGATGAAGTGTACACCTTTGAGGTGCGTACGAAATGCTGCGCCTACAGGTTCATTACGGTGGTGAGGCTAACTT
TCATTCTTGTTTTGCCGTGCAGGTTGTGGATTTCAACTCGCTTGCAGCGTCGCGCGTGAAGGTCATCCAAACTGACGTGAACGAAGACGTGTACCCGTAT
CTGGTATGTATCGCGGTTGTTGTATTTCTTTTATTGCATGCAGCTCAGATATTCAAACTCACTATCCCTGCTGCAGCTTGTCAGTATTGGTTCTGGTGTT
AGTGTGCTTTATGTGAAGGGCCCCGGAGAATACGAGCGTGTGAGCGGCAGCAGCATTGGCGGCGGTACCTATTGGGGACTTTGTCGTCTGATGACTCATT
GCGAATCCTATGACGATGCGCTGGATTTGTGTGTCCACGGCACCAACAAAACAGTTGATATGAGCGTTGGAGATATCTATGGCGGAGCGTACGACAAGTT
TAAGCTACCAGCGTCCACCGTGGCTAGCAGTTTCGGCAAAATGATCTCGACCTCCCGCGAAAGCGTGAGCGAAGCGGATCTGGCTCGATCGCTGCTGGTC
ATGATCACACAGAACATCGGTCAAGTCGCCTTTTTGAATGCGACCTTATACAAGACCAAGAACATTTTCTTCGTTGGCAACTTTCTCCGGCACAACAAGA
TTTCGTCACGGACACTGGCGTATGCTATCAATTTTTGGTCGAACGGAGCGATGGAGGCTCGCTTTTGCAAGCACGAAGGCTATTTGGGAGCGCTGGGTGC
GTTCTTGCGGCACGCGGAGGTAACTAACGCTCACGGGCACGAATTCGTGTCAGCAACTAGAGTATCGAGGCGACCATCTGAGATCTAGGATGGACGAAAC
TCGTGCAAAGTACTAGTGTGGATAGAGCGCTGCGTGCCAATAAAAGCGTTTATGGCTGTGGCTATTGGGTTGAGGCCATTGACAGCGTTTCATAGCGAGC
ACTAGGAACCTCTTGAGATAAAAACCTATGAAGGATAAAAAGAAAGTTTGCTGGGTGAAAACCAAACACGACAGCAGCTATTCCAATAGGGACATCATTG
ATGTCACATCAATAGGGACATACATGTACCAACTGGGCATTCCGCGTGGAACGTGGAACTGCCACTGGCAGGGCAAGGGCGCGATGAGTGCCGCCGGTAG
ATTACGGGTCACCCCCGCGTGCGCACAGCATACCATATAGGTACACTCGATTCTCCCAGATGAAGATGGTGGATAACGCCAAATTGTTCAGCGTTCATTC
TGCAATTTCCTACCAAGCGACTAAGCACCGCACTGCATCGCCACAACTAGACCCAAACCGCCATGCCGCTCACCGTTCCCGGCATCCACACCAACACGCC
GCTGGACGCGACCTTCGACAAGGACATCCGCGACCTGCACCTCATCTACGACTACGACGCCGAGTCGGCAGACGGCAAGCCGGAGAAGTGGCGCTACGAG
CTGTGGTTTTTCTCGCATGACCGTGTGGCGTACGCCATCCACGGCGGCCCCATGGCCGGCCGCGTGAACTACCAGACGTGCTCGTACCAGTGCATCCGCC
CCGGCGAGCTGTGGCAGTGCAACTGGCTGGAGGAGACAGGCACCATCGTGAGTCTGGTGTTTGACATTAAGGTGCAGAAGCTCACGACCATGATCGGCTT
CTCCAAGGGCCACTGGGAGCACCCGGTTGAGGCTCACGGCGACAAGCGCAACGCCAATGACTTCGCTCGCTGGCGCAATTTGGCCGAATACGGCAACCAG
AAGGACCGACTGCTATTGTGCGAGCA