Description :
From Genome Similarity Track
Location :
Scaffold_8:19644- 23851
Transcript NameFunction/comments
g3311.t1hypothetical protein

Sequence
4207 bases(100 bases per row)
TCGTTCATATTGCTTTCCCAATTCACCGATTTCAGATCCCGATCCGGGGCTGTCACCACTTATTTTTCGTCGATTGCATACTCATCTGTTTCCATACACC
CCACTCCTCTAAAACGGCAGCCTTCCTGCCGTTCCTTCTTCAATTTCCCGCCGGCGTGGCCAACCCACACCAACGGGTCCCGCCTCACTACTCTTCGTGA
GACTGCATCACACCAAATCGGTTGTGATTCGCGCGATCCCGTAGGAACTCATGTAACAACGCACCACAGTTGAGATCCGCTTCATCGATCCAGCTGGGCT
CTTCGTACCCACGCCAGTGTACTTGGAATTCGCGATAGATCCGTCCATATCTCGTACGCTTACCGGATCTCAGATCCGTGATCTTCTCGACCTCGCATTC
ATCGGATCCGAGATCCGAGATCCAGCTGTCTTCCGGCAATAGCGCCTCATCGAAATCTAGCCGATCTGCATTGTCGGCAACCAACTGAACTAGCGGGCGA
TCTGGGAACTCCTTCACCAACTTCAGCTTCGACACGTACCACCGGGAACAAACGGTTCTTTATCCCGGCCGTCTCGAGCTTGACCGCATACTCATGGATT
TTTTCAGCCACTCGAAATGGCCCGTGCCACAAGTGCGCTAACTTACGGGCGTAACCTTCTTTCACGCGATCCAAGTACAACCAGACGCGAGATCCAGCTT
CTATCGGGTGGGGTCGGACGTCGTCATTGTGCGAATCTGCTCGATCTGCGATCGCCTCACGGAGCTTTTCGTTGACTTGTTCTCGGACCCGCGTATAATA
ACGCTGGATCCGGTAGCGCCATCGGCGTGGATCACGATCTTGACGTCGAGTACTACCCACCGGGATCGTGGCTCTAATGTAAATCTAGGATCCCACCCAT
GTACCAAATAGAAAGGCGTATCACCTCGGATCCGATCTTGGGCTCTGTTTAGGGCAAACGTAAGCCGCTCGGCGTACTCGTCCCAATCCTGTTGATCCAG
ATCCTGGACATGCATCTTGAGTGCGCGCGTGATCGTCTGAACCATGCGCTCCGCCGTCCCATTCGCTTGCGGTCGGTAAGCCATAGTGGCCCTCTGACGC
TGTCCTAGGATCTTGTTGAACGCTCGGAAGAAGTCGGACATAAATCCTGGTTCCCGATCGTGCCGAATTACCTCGCTTGCGCCAAATCGGCGGAACACAC
ATTCTTCGTAGGATTCCGCTATCGTTTGAGCCGTCCTGGATGAGCTGGCCTTGGCTATTACATAACCAGTAAATAGATCGACCCAGATCAGCAACTCCGG
GTTGCCTCTATGTGGTTTCGGCAGCGAAGGTATGTGATCCATGGCTATGATCTGGAACGGATAGGTGGCTTGGATATTCCCTGGCGACTCGCCTCGGATA
GTGGGCCGACCTTTTCCGGTCTCGCAGTCTACACATTCCCCAACATACCGTTGAACGCTCCGATACAAGCCTCTCCAGTGGAAGTGATCTCGGATCCGCT
GGTAAGTGCGGCCGATCCCTTGGTGGCCTCCCTCTACACTAGCATGGTAGTGGTGCAGGATATCCTGATGGAGGGTTTCGGGTGCAACCAACCGCATCGC
GAGATCTCGATCTTCGTCAGACTTCCGGTTTGGTGGACAGTAGAAGAGTAATCCGTCCAGATCCATCTCGTAATCCATTGCCAGATTGCTGTAAGATCGA
GCTTCTTCCTGGGCCAAAGTAGCTACATCGCCAACCAGATACTTCTTCATTCCGGCGATCCATGACTCTTCATCTTGGGCCCGACGAATTCGCTCTATCC
TGAGCTCCCTCACCAATTCTTCCTGCATTACCTTCGGACTAGATCCGGATCTGACTCCAGATCGGGTGATCACCGGCGAAACTCGGACCACGGATTCTTC
GGACTGTACGGTTAGAATCTCGTCCAACCGGTTTAGGGTCACCAAATCCGGATAGTCTTCCTCGTCCACCAGGATCCCCGACTGTCGCTGAAGGGCAGCT
CCGGCGAGGCTGTCAGCGGAACCGTTCCAATCTCGCTTAACATATAGCAGCTCATGATCTGGCCACTCTCGCACTCGATCTAGAGCCTTCTATTTCAACA
GGATCAAACCTGGGGCCTTACAATCAATTTCCCCTCTCACTTGCCGGATCACCAGGTTGGAATCCCCGCAGATCACTAGACGTCCACGCTCCACTTCAGC
CAGGAGGTCGAAACACAACAAGAGACCATTATACTCCGCTTCATTCACCGTCATCCCTTTTGCATAACCCGATCGGGCTTTCAGCACGGTCCACTCGGGT
AGTTTCCACAGGATCGCGCTGTACGCGCCTCCTCCTCGTTTTACTCGGGCCGATCCGTCAAAGCTTACCACGTACAATTCTTCATCGGCCTTCACCGTGG
GTACAGGAGCTTGGATCTGCCGTCGGGGTTCTTTCTTAGGCGCGATCGCGATCAACACCTCCTCCACATCGGATCTAGGTGTAATACTGGCAGTCAGCGC
CCCTAGGATTTCATCTTCGCCTTTGGTGCACTTCATAATTTCAAGTGTCCATGGCGACAGAAGAGCTGCCCATTGACCCAGACGTCCCTGTAGCCCCGGC
GATCGGAACAACCATGCTAACGTCGAATGTCGACTTAGGATCCGGATCTCACGTCCTACCAGAAGGTTGTAATCAGATCCAAGATTCTTAGCAACGCCAA
CACGTCCTTCTCGACCACATTACAATTCAGCTCGTTCGACTTCAGTGTCCGATTGGCGAAAGTGACCGGGTAGTAGATCTGATCGTGACTCTGCATCACG
GCGGCGGAACTAGCCCATTCGCTAGCGAAGACAGCTACTACTGGGAGTAAATCGGGATCGAAGTGACGCAGAATTGGAGCTGTGGCGATCTTGTCCTTCA
ACGCTGCAAACGACCTATGTGCTCTGACCCACCTCTCGTCAGCTGCATCTACACCGGACATTACCGGGGTTGCAGTAGTTGAGTGGAAGATCTCGGGGTC
GGGTTCAGACGAACTGTGATCCAGGATCCGACGAAGATCTGGACGCTTCTTCAACTCAGCGAACTTCACTTCACGTAATTCATATAGAACGGCAGCATAT
ATCGCATAGTCCTCAATAAATCGACTGTAATAGTTCAGGCTGCCCAAAAACGACTGCATGGATCTGAGTGATCCCGGGAAAGGTAGATCCGTCAAAGTCT
TCAGGTCCTTCGGATTAGCTTCGATGCCATCGTCGGACACTCAATGTCCCAAGTATTCCACCCGGGGAAGACCCCAAAAACTCTTCACCACACTTATAGA
CAGGTTCCATTTATCACACGCTTCGAACAGATTCTCCACTCTGTGGCACAGTTGATCCCAAGATCCAGCTGTCACCAGGATGTCACCGATGTAGGATCTG
CGTCCTAACACTGACGGACGACCTGGATCTTCCGGTTCTCCAGCCTCAAAGGGATCTGGAGCAAGTCCTGGCTCGTCAGTAGGCGGGATCCGTGTAACCC
CATATAACGCATTATCCAGAAGCCGCTGATAGATCTGAGGCGCATTCTTGAGTCCGAAAGGCATCCGGTTCCACTCGAACAGGCCGAACGGAGTTATGAA
AGCCGAGATCGCGCGAGCTCGGTCCGTCATAGGTACGACCCAAAATCCGCTTGCCATGTCCAGCGAGCAGTACCAGGACACCTTGTTCAGATCCTCTAAT
AGATCATTGATCAGAGGCATGGGGTAGATCATTAGTCGAGTGAGGCCATTCACCAGTCGGTAGTCTATACACAGCCTGATGTCGATCCCGTTCTTCTTGA
TGATCACCACGATCGGTGATGCCCACGGCGATGTCGAATGTCGAATCATCTTTGCCGACAGCAATCCCTTGATCAGATCTGACACCTTCTCCCGGAACTG
CGGTGCTATCTTCCGCACCCGTTGCACGATCGGCTTTGCGTCCCCTACATCGATATCACATACGACTCCTCGGGCTGCTGGCGGTAAGGCATTACCTTTG
CCTATCAACAAGTGTCGTTTCTGCCAGATGATCTGCCGCAGACGATCGATCTCATCTGGAGTGCTGCGATCTGGATCACCAACCTGGATATCATCAATAG
TCACTTCGCTCGTCATAGCCGTGATCTCTGGCAATACTGCCATCTCGCCTTCCACATCGTCAGCTAGCAGATCACCAGCTTCGTGGTGATAAATATGCTC
ATCTTCC