Description :
From Genome Similarity Track
Location :
Scaffold_443:19642- 24386
Sequence
4744 bases(100 bases per row)
CTACCTATAAATAGATTCAGCTTACAACTTACCATAAATTGGTCACTTCGCTCCCTCAGACAAAAGGGGACCTGTGAACTACAGTTCACGGATAGTTTGT
ATACTCTCGAAAACAAACTTCCTCTAGCGCGAGGTGCTGTGTGACCCCGTTACACTTGGTAGCACCTGTAGTAAATCCATGCCAGCGCGGGTAGACTACC
TGAATCTCTCTGAAGTTCATCGCCATGGACAAAAGCGACTTCTCCCGTCTGAACGAATCACACTTCGAGTCGATTCAGAAGATGACCGGCGCCTTCGGGA
TGAAGGCCCTGCAGAGCATGATGGCGTCAACACCGGACGAGCAGCTTGAGCGCGTCAATGCGTTTGACACTTACGAGCAGGGGCTCATCGCACAAGTGCG
GGAGAACCTGCAGGCTCCGGCGGCGGAGACAAACCCGCCACACCCGAAGCCAAAACGGCTGAAGGTAAGGCCGTATGAAGGGAAGAAAGGTGAGAAGCTT
TACTTTGGGTTCGAGAGGTAGAGCTCGCGGTGGACGCGGCTCTGATCTCAACCGAGCATCTTCGTGTTGCGTTTGCACTCTCCAACCTTAGCGGTCGTGC
TAAGAGTTGGGTGTACACGCGGTAGGCGACACCCCCTGGATGTTTCACATTCTGGGCTCAGCTGTGCAGACTGCTCCGAGCCACGTTTCTCCCAGCGACC
TACAAGTACCGGCAGCGTTCGCGCTTCCTTTCATATAAGCAAGGAAGGCGCGAGCTGCGCGAGCACGTCCAAGCGATGCGGGAGATCACGGCGTCCCTAG
TGAGCAACACACTCAGCGAACACATCAAGGTGACCGTGTTTATGGAAGGCCTTCGAGTGGACCCGGCGCGCACTCAGGCGTTCCGTGTGCAGTCCCACCC
TCGAAGAGGCGATTCAAGTGGATCTTCAGAAAGAATATAGCCATCGCCAAGAGCGCACGCCGGCCTCAGCGGGGCCAAGGAATTCTGTGTTAAATCCCGG
GCGGGTCGGTCGCCCCACCGGACCCGTTCCCAAGGAGCTCGGGTCCGCCGAGCAGCGCGACATTCGCTGCTTCGACGGCGGGAAGCTGAACCACTTCAAG
CGCAACTACCCCGCAGAGAGACACCGCAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTGGCGGGCTGCTCGTAGTACACGGATGTGTACTGGGATACGACCCCCCCCTTTAGAATC
TTGATCGATTATGGGGCGTCGAAGAATTTTGCACGCCGCCAGACGGTTGCTCGTAATAGCAACAAGCTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACG
GGGCGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACCGTTCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGATTTTGACAGCCTCGAGCA
TCTTACTGCTCTCGACATGGATCCCTACGATATGATCCTGAGCATGCTCTGTCTTGAGAAGCACGAGCCCTGGATCGACTGGCGTGGCAGGGCAATCGGT
GCCAGCCGCCCTGCGAAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGAAGAACCCTAAAAAACCTCTGTCAGGACCCGAAGA
ACCCTAAAAAAAAAGGGCTGCCAGGGTACCGTAGCATTCAGCAGATGCTTGGGAGTCGTCGACGTAAATGACGACTGCGAGGACGCTTCTATGATGGCGG
CGCTAGGAGGCGCCGCCCAAGTGGGTAACTTAGGTCCACAAGCGGGTAACATAGTTCCGCAGACAGCTGCAGCTGTAACGAACGCTGGTAATAGCGTCTT
CAAGGTGGGTAACAGAGTTCCACACACGGTCGCCCAGACCTTAACTGAAGAGAAAGACGTCGGATACGCTTGTCGTGTGGGTAACGCAGTGCCACACGCG
GTCGCCCAGACCATAACTGAAGAGGAAGACGTCAGACACGCTTCATACACATATAAGACCTGAGACCACTCGGGAGGAGTTGACCCCCCCCCCCTCTGTC
TTGGACGAGGACGTCCTGGAAGATCTAAACAAGTAGCGTCAGACGCGCTTGGGTTTTGATATCCTTAAGAACCCCAAGGATCCGGGGTGTCCTTTGATGA
CGGTACGCGGACGTGGTGAACGAGCATTCACCGACCCAACGCCCACCGGATCGAGGCGTACAGCATGATATCGATCTCGTGCCTGGCACAAAGTACTGTG
TCACTGACCTCTTCCACGCGAACAGTGCGAGGTCTTCAATGTCTTCTTCGCTGCGAAAGCAAAGGCAGGCATGGTGCGGGAGTCGAAGTCCACGCACTCG
ACGCCAACTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCATCTAGTTCATGCTTATAGCAAGCTGAACAACGCGACGGTGCCGGCCCAGACACCAATCCA
CGAAAGGATGTGTTGTTGAGCAACATGGCCGGAAGCGTAATGTACAGTGCGCTGGATTTGGTAGACGGATACTACGAGATCCTGATGCGCGAGAGCGACA
TCCCGCTCACCACGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCTACTGGGCTTGTCTCCGGCGACATTCAACCGTCTGGTGACGCA
ATTGTTTATCCCAATGCGCGCCTTCGTACAGATGTACTTCAACGACATCGTTGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTG
GGGCACCTCCGTCGAGTGCTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTCTTCGCGTAACCAGATATTAAGGTTATCGATT
GCTTCGTAAGCAGCGTGGGCGTTTGGGCTGACCCAGACAAGGTCAAGGCCATAGTAGCATGGCCTACGCCTTGATCCCAGAAGGATCTTCGAAAGTGGAG
GGCTTGGCCAACTACTTTTAAACGTACAACGCACAGTACGCGGGCTTTGCTAAGCCATTGTCGGGCCTCCTTCAGAAGGGGGCCGACTGGCGCTAGGAGC
AAGAGCACGATGATGCTTTTGACAGCATCAAGGCCACTCTCCAAGACGCCCCTGTCCTGGCCCTGCCTGACGAGACGAGACTAAGGCGATAAGCGTCGTC
TGCGATGTCTCCGATTATGCCATCGGGTGTGCACTGCTGCAGGCCGACACGGTTGGCATGAACGAGCCATCTATGTCTACGATTATGCCATCGGGTGTGC
ACTGCTGCAGGCCGACACGGCTGGACATGAACGAGCCATCTCATTCTAGTCCAGGCAGCCCAAAGCCGTCGAACAGAACTACCCTGTTCACGACAAATAA
CTTCTGGGAATGAAGTACGCCTTTGTGAAGTTTCAGGTTTCATCTTCTGGGCTCACGGCCCTTCGTGATCTACACAGACCACGCATCCTTGAGGACGGCG
ACAAATTTGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGCCCTTTTCGCGGAGTACAACTTCCGCGTTGAGTACAAGCCGGGCAAGCTCAGCGTGCT
TGCGGACGCCCTCTCTCGGCGTCCAGACTACGAGTTGGCCCACACCACACGGGTGACAACTGATCTATATGATCGGATACGCAAGGCGTATCGGGAAGAT
GAGGCTATCGCGCCTATCGTTAAGTTCCTCACAGCAGGAACGAACGCGAAGTCCGACTGGCTTTCGTCGCGACAGCGCTCCCGGCTCCACCGATATGAGT
TGAAGGATGGCCTCCTCTATTACCGGGTGGAGCCCAATGAACCTCCACGGGTGGTCGTACCCAACAACGAGGATCGGACGCTCGACTTCCTCGTGGAGGC
GCACGACGCGCCCTCCAGCGGCCAGTTGGGTCGCGTGAAGACCTTCTTGTCGGTCTCTCAGGTCTTCTGATGGACCCACATGTACAAGTGAGTCGCACGA
TACGTGAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACGATTCGGCTCCACTACAGATCCTGCCCGTTCCGGCTGACTGTTGGAAGTCGA
TGAGTCTTGACTTCATCTTTCGGTTCCCCGCCGACGGACACGGCAACACCGGGATTTTGTTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCC
AGTACCCGTTACCGTCACAGGTGAACACACCGCGGGGTTGTTCATCGTTGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGAC
CCGCGGTTCACGGCTACGTTCTGGAAAAGGCTGTCCCCTTTACTAGAAACGAGTCTGCAGATGTCCACTGCGGATGATCCTCAGGCAGACGGTCAGACAG
AGCGCGTCAATCGAGTGCTCGAAGATTCTATGCGCAGTGTGTGCGCGGACGCACCACGTACGTGGTCGACGCATCTTCCAGTCGTTGAGTTTGCGCTCAA
CAACGCGATGGACGCGTCCACGGGGTTCACGCCATTCTACCTGAATGGCTTCCGCCACCACAGAGTGCCTCTCTCGCTTCGAGGAGACACTGCATCCTCT
ATTCTATGTTGGGGAGAGGCTCGAAAAGATCGTTGGACCCAGGT