Description :
From Genome Similarity Track
Location :
scaffold_1114:1964- 4682
Transcript NameFunction/comments
g11016.t1 reverse transcriptase

Sequence
2718 bases(100 bases per row)
TCGGTGAGATCGATCGTGTGGAGCAGCGCCTCGACTGGTGGACGCTCCCACGGGAGGTCTCGGACCAGATTGAGCAGAATGCTCAGCGCTTACAAGCGGC
GGAGACGGCTGCTGCCACTCTCGAGTCACGTGTGACTCACCTGGAAGGCGTCGAGACTCGTCTCCAACCCGCGGAGCGGGCGATCTTGGAACTACGAGCC
CAGCTCGATCTTCTTGTGCGCCTCCAGATCCACGCTCCCCCTCCGGGCCCTTGGCCTTGCGCGGAGCCAGCGCCGACGCGCTCACCTGAGCTGGGTCCCG
ATAAGGCTTAAGCAAGCCCACGTAGAACACCGGGTGTGTTCGCATCCTCTTTGGGAGGTCAAGCGTGTACGCAAGGCCCTTCTTGGCCACGACCTTAAAC
GGTCCAATGAAGCGAGGACGCAACTTGGTCTTAAAGACCGCTGACACTGCATGCGTAGGTAGGTTCTTAGCGTTTAATAAAACCAGGTCCCCGACCTCAT
AATTTTCAACATTGCCTCTGCCTTTAGCATCAGCATGTTCCTTTTGTTTGTCTTGGCTCTCAGCCATAGCGTCACGTACATGTCGAAGGACACTCAGACG
CGTGGACAAGTAGTCATCCACCTGTTTACGAACAGTGAGAGGGCTGACATCAGCAAGCCGCTCGGCTATCTCTCCCCCCTCAAGCCCTGAACCACGTGGT
GGTGGCGTGAAAGGAACACGCGGGTTTGTCAAACCATTGACGTAGAACGGCGTGAAGCCTGTGGAGGCATGCACCGCGTTATTCAACGCAAATTCCACAA
AGGGCAGCATAGCGCTCCAACGCTTCGGCGTTTCTGCGCAAATGCTCCGGAGGATGTCCTCCACAACGCGATTCACGCGTTCCGTCTGACCTTCGGTCTG
CGGATGGTCCGTCGTGGACATGTCCAGCTTGGTGCCAAGCACCTCGAACACTGAGGACCAGAACTTGCCCGTGAAGCGGGGGTCTCGATCCGAGACAATC
GACTCAGGGAGTCCATGTTGCCGGAAGACACGGTCCATAAAGACTGTCACAGTCGCTTTACCATCGATGGTATCCGGCACCGCCGCCATGTGAGCCATCT
TGCTCAGCCGGTCAACAAAGAACACTACACCCGTGTTGCCATCCGAGTCCTTCGGAAGGCCAAACACGAAGTTCATGCTCATGGATTCCCACAGTCCCGA
GGGCACAGGCAGACTCGCCAGTGGCGCCGCCGCATGCGGGGATGGCTTCACCCGCTGACACGTCTCACACGTGCGCACGTGTGTGCTCGCCCACTTATAC
ATCTTGGGCCACCAGTAGTGAGTGCTCACGGAGCTGTAGGTCTTTTCCCGACCAAGGTGCCCGCCGAAAGGCGTGTCGTGAGCCTCATAGAGGATACGGT
ACTTCAGATCCTCATCATGAGGCACCACTACTCGTGGAGGATCCTCAGGATCGGTACTGTAGTACAACAGGCCCCACCATCGAGCGAATATCGATGCAGC
CTCGCGCCGACAGTTTTCTGTCCGGGTTCTCAAACTCCTTGTTTCCCAGGGCACGTAGCACAGTTACACACGAATCGTCGTTAGCATACGCCTCGCGTAT
CTGATCCGTCAACGACGACGTCACCATCGTGATATGAGCGAGCTCATAGTCTGGCCGGCGCGATAGCGCATCGGCTAGGGCATTCTGCCGGCCCGGCTTG
TACTTCACCTCGAAGTTATACTCCGCAAAGAAGGAGAGCCATCGGGCCATCCTCTGTGAGAGGTGAGGCGACTGCGTCGCAGTGCGTAGCGACGCATGAT
CTGTGTAGATCACGAAGGGCTTGGAGCCGAGCAGGTGGACCCTGAACTTGACGAGAGCATACTTCATTGCAAGTAGCTCCTTGTCGTGAACTGGATAGTT
CTTCTCAGCAGCCTTGAGCTGTCGAGACTCAAACGCGATCACGCGTTCATGCCCGTCGGCATCTTCCTGTAACAGGGCACTGCCGATGGCAAAGTCCGAC
GCGTCACAGACGACACTGAAAGGACGATCAGGGTCTGGCAAGGCCAGTATAGGGGCATGAAGGAGGCTCTCCTTAACCGCCTCGAAGGCGTCGTGCTCAC
GAGAGCCCCAGCACCACTCAACATCCTTCTTAAGGAGATTCGACAATGGCCTAGCCATCTCCGCATAGTTGGCGCTGTACTTGTGCAAGTAGTTGGCTAA
GCCCAACCACTTCCTTAAGTCCTTCTGCGTCATCGGAACCGGCCAATCCACAATGGCCTTGACCTTGGCGGGGTCCGCCCTAAGGCCACGCTTTCCCGTG
AAGCACCCTAAGAAGGGAATGTCTTCTGCTCCGAAGATGCACTTGTCTGCGTTAGCATACAGCTTGTTCGTGCGCATGCACTCAAGCACCGCTCGCAAGT
GGTCAACGTGGTTCTCCACATCCGACCGACCGTGCTCCGCACGACTGTGGACGAAGATATCGTCAAAGTACGTCTGTGCGTACGCCCGGTGGGGCCTGAA
CAACTGCGTCACGAGACGATTGAACGTCGCTGGTGCGTTCGATGGCCCTTGGGGCATCACTAGCCACTCCCAGAGCATACCGCTCGGAGTACTAACCGCC
GTCAGCGGTATATCTTGTACTCGCATGAGCAACTGATAGTATCCATCGACCAAGTCGAGGGCACTGCACATCGTACAGCCCACCATGTTGTTCTGAAGAA
CATCCTTCCGAGGAATCG