Description :
From Genome Similarity Track
Location :
scaffold_48:196364- 217178
Transcript NameFunction/comments
g7467.t1 hypothetical protein PHYSODRAFT_496419
g7468.t1 hypothetical protein PHYSODRAFT_359947
g7469.t1 hypothetical protein PHYSODRAFT_492857
g7470.t1 hypothetical protein PHYSODRAFT_492063
g7471.t1 hypothetical protein PHYSODRAFT_313186
g7472.t1 hypothetical protein PHYSODRAFT_488938
g7473.t1 hypothetical protein PHYSODRAFT_313188
g7474.t1 ABC transporter ABCF family

Sequence
20814 bases(100 bases per row)
TAATGAACGCGAAGAGCGCTGCACTGGCGGAGGCGTTGGTGCCGGCCACGTACGTGCAGCAGGGACTGGATGCTGTACGCGGGCGGGAGAAGCTGGTGAT
GACGCTACTTTCCCAGCGCCGCCTCCCGGACGACGGCTGGGACGACACCAGTGTGGAGCTGCTGCTGCACACGCTCTCGGCCATGGACAGCAACAATTTC
CGGGGCAGCGCCGGCGCCGGCGAGCGCGAGGCGCGCGTCTTCTCTGCGCTGGTGGCTCACCGCCATTTCAACTTGGCGCACGGCGTAGGCAGATCGGGTG
ACGTGGCGGCGGTGCAGCCCAAGGCCGCGGGGTCGTCTCTCATGGTGCAAGTGGCCAACGCCCTGGCCAGAGACGTGCTGCGTCTCGCTGGGATGCGTGC
GGTGCAGGCGGCGCTAGTGCTGCCAGTAGCCACGGGCATGTCGCTTATGCTGGTGTTGCAGCAACTCAAGGAGGCGAAGCCAATTGCGCGCTACGTCATT
TGGCCGCGGATCGACCAAAAGTCCTGCTTCAAGTCTATCCTGGCGGCAGGACTGACACCGCTGGTGTTGGCGAATATTTTGGTGGAGGAGGAAGGAAAGA
AACCAGGAGGATACTTGAAGACGGACCTGGCAGGCATGGCAGCACTCATGGATGAACATGGCAGTGACAGCATCGTGGCTGTGATGAGCACGACGAGCTG
CTTTGCGCCGCGCGCGTACGACAGTGTGCAGGATATTGCCAAGCTTTGTCAGGAACGCAACATTGGTACGGTACAAGTGGGTTGTGGATGCTGGGCTACT
AGCTGATGAAAGAAATTGCTGTGCTGGTTTATTGTTATGGTGTTGAAGCACATGTGATCAACAACGCGTATGGTGTTCAAGCATCCAAGTGCGTCCACCA
AGTGGAAGTAGCTATGCGCACAGGGCGTGTAGATGCCGTGGTGCAGAGTCTCGACAAGAATTTTATGGTCCCCGTAGGTGGAGCAATTGTCTGCTCAACA
TCGCGAGATGTTGTTGACCGCGTGGCGAAATTTTACCCGGGGCGAGCTAGTGCCACCCCTACGTTAGACTTCTTCATCACCATGCTTCAGATGGTAAGAT
TTACCCTCGTCTTTGGCTGCTCTCTAACATTATTTGTGTCTGGCTCATGAATCTATCAGGGGAGGAGCGGATATCGACGGCTTCTTGACGAGCGCAAGCA
GCTTGCAGCTTATATGCGCGAGCAGCTTGAAGCATTAGCAGCAGAGGAAGGCGAGCGCGTGCTACACGTCTTCAATAACGAGGTACGGGGATAGCGATTT
ACTTTCAGTTCATCGAGTTTGATAAGTCGACCCGTTTCGTTCGTATGCACAGATATCCTTTGCGCTGACGCTAGGCACATTCTGCTCGAATGCCAAGGAT
CTGCAAGAGAAATCTCGGCAGCTTACGTCGCTTGGCGCAATGCTCTTTTCGCGTGGAGTGTCTGGTGCACGGTAAGTTCAAGACTAAGCTTAACGTTGAG
TTGGAATTGCTATCGGTCATCTGACGCATGCATTGCCTCAGAGTGGTGTCGTGTCTCGATAGCAAGACAATAGCTGGACACAACTTCAATTCATTTGGAG
CGCACCACGACGCATTTCCCGTGGCCTACGTTACTTTTGCCTGCGCGTTAGGCATGCAACAAAACGAGGTCGATCTGCTCGTCACGAAACTGCGCAAGAC
GATCCACGAGTGGAGAGCGAAGCAGAGCAGGTCGATGGCTGCCGTATAACGTCGCCACTCACCTCAAGTACATGTAGTTCAGCACTGGAGAACGGAAAGC
AGTCAAAATGTTGACTACTGTGTCTATAAATCTGTTTCCTGACGTGCTATCTTTTCCTATTGCTCTCTCCTTTCACTAACACAGCAGTCGCACTGAATTG
CCTAGTGCTTCTTACTGCCGCTCTTCGTCTTCCGAGTTTTTTTCTTGGCCGCAGGCGGGGATCCTGCCTGTTGGTCAGCCTCCGTCTTGAACTCAAGCTC
TCCAAGCAACTCGTTGGCAATGGCATCAGCAGCCGCAGCGGCATCCCCTTCACGGCGGCCCTTCGCGCCCTCCACAGCCTTCTCAGTGAATGCAGCCATA
AACTTGGCCGAATCGATCACACGCGGATCTTCCTCACCGTATGCCTCCTTGAAGAGCGAGTACACCTTCTTTTCGTACGTGAGGGCCTCGCGGAAGCCAC
CGGCAAGTCCACAAGCCATAGCCATCTGGTGGAGAACATTCGCAGCCTGGTTGCGGTCAAGCTCGCCGCGTCGGAGAGACTCGCGGTGGCACATCAGTGC
CAACGTGATCTGCCCCACATCTTGGCACATCATACCCATCTTAAAGTAGAGTGAGCTGATCTCAGGGAAGTGAGGTCCGCAACAGAACTCCAGCAGGTAA
ATGGCACGGCGAATGTGTGGCACCGCCAAATCCGTTTGGGCATTGGCGTGCAGGAATAACGACAGGTTGGCGTGTGCGAAGGCCGTGTCGTGGTAGTCGA
TGCCCTGAAGCTGTGTGTACAGAGCGAGCGCTCGCTGCTGCTGTGCGATAGCACCGACAACGTCGCCAGCGTGATAGAGGACAGTAGCGAGCGACGAGCT
GCAGAGAGCTGCATCCTCGTGGGCGGCACCACACACCTGGAAGAGCAGAGATGAAGCCTCCTGGAGGAACTCGTACGCACTCGACAGCGCTCCTTGGCCC
AAGTGCTGGCGGCCACGCTCCAGGAGCTGCTTGGCCTGCGCGAACGGGTGCGCAGGCAGCGAGTGCTTCACGACCGGCACCACGCCAGTGATGTCATCCA
GGCTAATCGGCGTGGCGCACGACGATGAGAAGTCGTAGTTGCGGCTCACCACACGCAGCCCCAGACGCTGGCACAGACGTCGCAGCAAGACTATTCTGTG
CGCGCGGCCCACTGGAAAGGTGGCGTCATCAGCACTGGCCTCGCCACGGCCAGGACCCCACAGGGCCAACTTGTAGTCAAATCGGGCCTTAATCTCCTTG
TCAATGCGAGACCAAAGCGTGTTAGCATCCAACGACGCCGTCGTAGTAGCAGCGGCATCATCAGTCTCGAAGACATCCTTCTTGTCCGCAACAGCAGAAG
TCGATCCAAGAATGCCGTTCAGGAGCTTCACAATCGCCGATCCTGGGGCAGCACGAATGGAGTCGTTGGAGTTCAGAACATCAGCCAGGATGTGTTTGGC
AACGCGAGATATCATTTCCACCTCGAGCACTTCCAGAAAGTACTTGGAGATACCGCCAATCGCCTCCAGCTTCTTGGCAAGCAAGGCCAGACGACCCAGG
TAACGCATATTGATGCCGCAAGAGTGCATCAGCTGCGTGAGCGAGTAGCCATCCGCAGGGGCGCTAGCGCCACGGCGCACGTCGGCTACAAACGCTGGCA
CAACAATCCTCTGCAGATACTCAGCAGCATCTTTCGCCGCTGTTTCATCAGCCTCGAGCTGCTCCGCATTCGTTGAAGCCGCATAATCCATGAAGACGTT
CGGGTTCAAGAGCACCGGAGGAACCGCAGCCGTCTCCTCTTCCTCATCGGCCTCCTCAGTCTCCTTCTTCTCGGACGTAGCATCTTCCTTCTTCTCAGTG
TCAGCCTCAGCACCATTCTCCTTATTCTCATTTGCTTCCTCCGCCTTCTTCGCTTCCTTTGCTGCAATGCGAGCCTCACGGTTGACACGGCGGGCTTGGT
TCTGTTTCCAAAGCGAGTACAACTGGACCAGTTCCGGGCGCAGCAGAGCCGCGTAGCCTTCGTCGTTGCGAGTGAAGCACAATCCATCTTCTTCGGACGG
AATAGACTTCTCCTCCTGTTTCTTTAGTGCAGTGTCGCGGCTCTTATAAAATGTCCAATCCTTCGGCGTGATGCGGACCAGATCCAGGACATACAGACGG
CCATCAGAGCCCTGGATACCCTTGGCCTCCACAGCACCACAGATGGTTGCCACATCGGTGCTTGCCTCACCACCGCTACCAGGTGCAACACCAAGAGCCT
CCTGTTCCTTCTCAACGGCCAGGTCTTCTTCGGTCTTACCAAGAGGCTTAATGCTACGCTCTGCAATGTGCAGCTTCTCGCCCGCCTCGAGCATGAGCTT
GTGCATCTTGTTGTTGGCAGCAATGGTCTTTCCGTGGTCCACAGAGCCGTACACCAGCTTAGAAGCTGCATCTCCCATCAGGATGCCCGGGATAATACTC
TGGGCAATAACACGGACACCAAGGTAGTCCACAACCGTCGTGGCCAGGGTGTGGAGACCACGGACATCCGCCTCGTTGAACGCCTTCACACCTTGCAGGT
CTCGGTTGGCAGCCGAGTAGGCGTTCTCCTCTCCTCCAGCGGCATCTTTGGTGGAGTTGCCGTCGATCGACATCGAGAAGAAAATGTTGTTGAAAACGTA
TACGTGCGCACTCTTGTCGTCCATGGGGTTGATAGGAGGAATGTGTCCCTCAACGATAGCAACCGAGCCCTGGGTTGCTGCTTCCACGAACTCCGTCACA
ATCTTGTACATGACACGAGCGCGCACAATTTCGTCCTTCAGCGAGTCGGTCGACAGCTCACGGCAGCATTGATACTCCTCGTTCCAGTCACGCAGCACGC
CACGCTCATCCATGCCGAAGGACGCGCAAAGTTCGTCTTCAGCGCGATTGAGGTCGTACGTGTGCTCCTCAGTCGCCGTGGCAGCAGGGGTGTTCCACGG
CAGCTTGCCACCCAAGCTTGATCCAGCCGCCACCATCCACTCGATAGAAGAAGGCCCCTCCTTCGCCAGAGAAGCAGCCTTAGCAAGGAGAGCAGCGTAC
GACTCCCTGAACTTCGGCGATACGGAGCTCAACACATCCACCAGCAGATGCGCGTGGGCCGCAGCGGTCTTGTGCGGACGCGGGTCGAACTTGGTGGCCG
TCGAGCGGTTCACAAAGAACCCATTGACGTGCGCCGTGATGTGGTAGCGCGTGTTATCGCCAGCAACCACCACCTCCAGGTAGAGCAAGTCACCCGCGAG
TTTGCGGGGTCCTGGCGGCGGGTTGTAGCCCGAAAACACGATGCTCTTGACACAGGTAGGGAGTTTGGCATCCTGCTGCTTCTGCTCCGGCTCCTTGTGT
TGGTTGGCCTCGTTCTGCTTCTGCTTCAGCTGGTTCTTCTTCCCTTTCTTCGCCTTCTTCTGGTCCTTGGCCGGCGTTGGCTCCGCGTCCTCCTGCGCGA
CGGGGGTTGGGAAGGCGTAGAACTCGGCAAGCTCGGGTTTCACTGGGACTTCGACCCCCTCGAGCTTGTGGTGGATCTCGCGCAGACGCTTGAGCTGCTT
TTCGGACATCTCCTTCAGCGCCTTGTCGTCCGGCTCCTCATTACTGGTATCGGCCACACCTTCCGGCTGAGCCTCGGGCTCCGTGGCTGCCTGGGGGATG
GGCGGATTGTTTAGCACGTCCCGGAAGCGACGCACATGGCCGCGCACCTTGCGGGCGTCGAACTTGTCCAGTGCCATGCGCAGCGTCACGCCGTCCGCCA
CACTCTCGTACTCGCCCAGCTCCACAAAGTCGTTGAGCGGCTGCCAGGAGCCGTCCGCCGAGCTCTTGGCCTCCAGGTGGTAGCTCGTGTAGCATGCGAG
CGCTGGGAACTCGGCGATGAGCTGGCGCAGAGACACGACCGTGTCCGAGGCCCCCACGCTTTCGAGCCGCACGCACTGGCCGCTCTTGGCGGCGGGAGGC
GCCACCAGCACACTGAAGGTTTGCTCTTCCAGGGCCAGGAGCTCTGCCGGCTGCTGCTCTGCCGGCTGCTCGACGGTGTCGCTGCTGCCCATGATGCGTG
GAATCTGCTTGCTTTACGGGGCTGTCGTTGCGATCTGAGCAATTGTGTGGTGCGTGGGCAAGACCGAAAAGGCTGATGGACCATTGCAAAGGGGCAATGG
CAAGACAGTCATTTACCGAATTTGTTCAAGAATAAGTAGTGCCTCGTGCTGGTCCGATAGCAAAAGTCAGTCAAACGGGTTTGACGGGTATGCTATATCA
GAGGCTTGAAGTTGTCTTTCATCTTCAGATTGTGGCAAATCACTTGGTGTTTGTAAGAGATCAGGCGAAGTACGTCATGTATCTGGCAGACGCACCGGAA
AAGCCCACCGAGAATGGAGAACATCTTGGCACTGGAGCTGTAACGAGCACCACGTCAAGCCACATCTGGGCACTGGAGCTGCAACGAGCACCCCGTCAAG
CCCGCATGCCTCCGTTCACCCAGCATGAACAGACTTTGCATCAACCACCAGCACCAGCGCTTTTGTACCAGTTTTGATGGATACGTTGGTGTGTGCCACA
CACAGACATGCTCATCCGAGCCCTTCGCCGCAGCTTCCTGGCGTCCGGACCTACCTCGTTGTCGCGTCGCTCACTTGCGCCCTTCACCTGCCGCACCATG
AGTTCCGATGAGCGCGCCCAGGCCGACGCTGCGGCCGCCTCGGGTGCTGCCTCCGCCGTGGGCGAGACCATCTTCGACAAGATCATCAACGGGCAGATCC
CGGCCAAGATCGCGTACGAAGACGCGCAGTGTCTGGCCTTCCACGACGTGAACCCGCAGGCGCCCGTGCACATCCTGCTCATCCCCAAGAAGCGCGACGG
CCTCACGCAGCTCGCGCACGCCGAGGAGCGCCACGAAGCCGTGCTAGGCCACCTGCTGTACACTGCCAATCTGGTCGCCAAGCAGCAGAACCTGGACAAG
GGCTTCCGCATCGTCATCAACGATGGAGAGGACGGCTGCCAATCGGTCTTCCACCTGCACCTGCACCTTCTTGGGGGACGCAAGCTGGGCTGGCCTCCTG
GATAAACGAGGGCATCGGCCGCCGCCCTGTGTCAATGAGGGCCCATGGACCTCTGCGAATTATTCAGGTACAGGCGTGTATGTTTGAGGTAACCAATGCT
ACGATGCTGGCCTACTACGCGTAGTTACTTGGTCAACGTTATGGCGGTCTTTGAGGGCGCCACTTGGTTGTCTGGGCGGTCTATCCTCGGCCGCTGATCT
CTTTGAGGAATTGATCCAGGAACGTCTCCATGAACGCGTGGCGCTCTTCTGCCAAGCGCTTGCCGGCGTTGGTCTTCATCATGCCGCGGAGCTTCAGCAG
TTTCTGCAATGACAACAAAGTTCCCAGACGTTAGACAAGAGCACCACCGGAATCAGACAGCGACGTACCTCGTAAAAGTGGTTGATCGTGGTGTTGGGGC
GGTTCGGGTCCATGTACTGCTCCTTGGTCATGTCGTCAATTGGAGGCACATCCGGGTCGTACAGCGGCCGCAGCTTGTGCCCTCCGAACGTGAAGCACCG
TGCGATTCCAATGGCTCCAATCGCATCCTGCACGTCAGAAGCGGAAACGTTGTCAATCAGCACAAATGTCCGTTGCTGTTAGTGGACAGATAACCTACCA
GTCGGTCGGCATCCTGGACGCAGCCATATTCGATCGAGTACGATCGCTGGCAACACCAAGCAACGAACAGCATTAGCCACATGACTCCCATCCAACCAAA
CCATCGCCACTCAAAAGGTAGCATACCGAGCCGCTGCCAGCCAGCTCCTCCTTGAACCCCATGCTGTCAATGATAGTCATCACGCGCTCAATCTTGTCGC
GGGGCACGCTCTCCGACTGCAAGAAAGCCACCGCGCGCTTCGTGGGCTTGTCCTTGTCGCTCTGGTATTTCCAGTCGTCGATATCGTGCAGCAGCGCCGC
CAAGTCCACGATCTCCAGACTCTCCGCTGGCACTCGCTGTGTGGCACACGATGCACCCGTCAGCAACAGTCACGCGCTCCCAATCCTCCGCTGCAGCAAA
CCTCCTCCCTGGCCAGCGTCCTCGCCACCGTCCACACGCGCTCGATGTGGCGCCAGTCGTGGGACGCGTCGTTGCTCTTGAGCTGCTGCTCCACGAACGC
CGCTGTGCGCTGCACCAATCGAGAGGTAGCCATCCTGGTCCGAGGCAAATTGCGCAATGAACAAGACAAAGCACAACCATCAGCTGTCGTACAGCGCCGC
CACTTGGGGTTCGAGTTGCTGCTGCTTGGCGCGAACATTGCTCGTCTCTGATTGGCTAACTCGCACACCTTCAACATTGAAACTCCCCGCAGTTCCCCAA
GAGGCAGCACCATGAGCAGCTCCCGTAGCCGGGGCCCGACCCATGCGGCGGTGACCGCCAAGAGCGAGCGGCCCCGCAAGATCACGGCCAAGGCGGACGA
GCTGGACGCTTACATGGAGAAGCTCTACGACGACGACGTCGAGTCTAAGCTGGACGGGGCCAAGATGATTCTGCAGCTGGCCGAGTTCGCCGGCAACATC
GAGGCACTCGTGCAGAACGAGTCGCTCATGGTGCGTTCGGGTGGGAATAGCGTACTAGTTGCGCTGCTGATTGCTGTGTTGTTGCTTAGAGCCTGCTGTC
GCGCGTTCTGAACGACGACTACAAGAAGAGCTATGACTTTTCGCTTACCATGATGCGCATCTTCTGGTGCTTCTCCAACTTCTTGCAGCTGCATCCAGTG
CTGGGCAACTACCGCATCGGAGCCATCACACTCAAGATCGTCGAATTCGAGCTCAAGCGCCACCAGCTCCGGCAAGAAGAGGAGAAACTTCTCGAGAGTG
CAGTCAACGGAGCCCCAACAAAGGGAGAATCAACTGACGGCATCCTAGCGAAACTAGACCGCGAGAAGAAACGCAACAAGAAGCGTATGAAGAAACAGGA
CCAACTACTGTGAGAATCCTTCGATGGCAGCGGGATATTTGTGACTGACTCGAAAATTCGTTCTTGTAGCAATGTTTGCTTCAGCGTGTTGCTCAACTTG
GCCGAGGACATTCACACGGAGCGCAAAATGGTCAAGCGCAAGATTGTGTTTTTCCTGACCAAGGTTCGTGTCTGTATTTAAGCTGCTGGCCGGCTTGGAT
GTCAAACGTTTGTAACTTACATGGTTTATTTGCTGCGTAGCTGCTGGATCGCGTGGCTCCTGACTTGGTTATCCTTACGATCACTTTCCTCAAGAAGCTG
AGCATTTTTGAGGAGAACAAGGACGCAATGGTGGAGCTTACCGTCGTGGAGAAACTCGTTCGCTATCTCAACTGCAACCACGACAAAACAATCCAGACGG
CACTCAAGCTGCTGTTTAACCTTTCTTTCGATCCAGCTATCCGTGAAGTGCTGGTGCGGAATAGCCTTATTCCAAAACTTGTGGAGCTACTCAAGAAACC
TCCCTTTCGTGCATTGTCACTGCGGATTCTCTATCACCTAAGTATCGATGATCGATGCAAGTCCATGTTCACGTACACGGAGGCTATCCCGATTGTCATG
CAACTCGTGATAAATTTTCCGCAGAACATCGTGGCAAAAGAGCTGGCTGCTCTGGCGGTGAACCTCAGCCACAATGCGCGCAACGCCGAGCTCATGTGCC
AGAACCGCGGTCTAGAAGCACTTGCAACACGCGTGTTCCGCACGCGTGACCCGCTCCTGATGAAGGTGATCCGAAACATTTCACTTTGGTCATATACGCT
ACAAGAAGACTTGGTCAGCGATAAGGCGTATAAGTACCGTGGTATGTGGGCTCCATTCGTGGTTCCGTTCATCGAGCTGTGTATCAACACCGACAACCAC
GACTTTTCGATCGAAGTTCTGGCAACGCTAGCCAACATGACACCTAGTGATTTGCCTCCAAAGACATCATGGAACAAATTGGTGACGGATCAATCGTTAA
TCCCTTTCCTCAACAAAATGCTGGTGCCAGGCTTTTCGCAAGACGATATGATTCTTGAAGTCGTGCTTTTCGTTAGTGCACTCGCGCTGGAACCGAAGTG
TGCTCCTCTCTTATCGTCATCTCGGCTGGTGCGCACGTTCCACTCGCTGTTCCAAGAGAAGCAACACGATAACGAGCTCACATTGCAGTTGCTTTACGCG
TTCTACCGCATGCTTCGCCACCCCGAAACCTTTGAGGAAATTCTCTTTGGAGTAGGGTTTGTGCCGGACTTGCTTCTCGCTGCTGATGCATCAAACATTG
AAGTCCGCCGGATGTGCGACGTGCTCATGGACTTGATTCTCGACCACGATCTCAATGACGGTGCCATCGGCGACTTTGGACACCTCATTCGGCAACGCAG
GTTTGAAATCCACAACGCTGAGTATCTCGAAATGATCCATGCAGAAGCACAAAATGCAAGCTACCGCAAGCACCACGGAATGGATGACAATGGTGGCAAG
GAGGACGACGATGACAACTAAGCGGCCAGAGTATCATCATCCGGAACCAGTCCAACTCATTAAAAGACCGCGTATACTTCTGTAGCCAGACTTAAACCTT
TAATCCTTGCGGTAAACTGTTCCACGCAGTATTCTTGCCTGCAACGATCCTACTTCACAAACTCAACTAATCCTTTTCCTCGTCAGGAACCCAACCACGC
TCTTCCGGTCAATGCCAAAGCGAGGCAGTGCCTTTTCCGGCCAATACGTATTGTCCTCGCTGTTAATGGACGCCCCCGGTGGAATCACGTACATGCTGTA
CGGACAATTTGGTGATATGGTCATTGCAAGCGCGCGAGAGTTGTGTTTCCTTTTGTCCGAGTAGCGAACGAGTTGCCGCACGAATTTCCAATGGTCATAC
GCCGACTCTAGACAAAAAAATGTCATAGCCGATTCATGGAGATTACGCACTTCTGTCTCCAGTCTTTCCATCCCGACAGTTCCTCGCTGCGTCACCACTA
TACTTGGGCTCTCGGGAAATGCTTCAGGGATCATTCCGTCTCGCGTACGGCACCAGAAGGCATCCACGCGAAACTCATGGTAAGTGTTGGTATCGGATGC
GTCCTGAATCTGGATACAGCATGACCAAGCGACGGAGTTCCGGATCATTGGATTGTCGATCTCCATCTTTTGATCTTCTCCCTCGGGAAGCTTTGAATCA
AGGCCACAATCAATCAAATCAATGAAAAACTGTGCTGCTCTCCACTCAGCCAAGCGACGGGCCTCCGCTTCTGTTTTCCATGTAGCTCTACAGAGAGCAT
GGCCATCGACTCGAACGACACAGTGCACACCAGGGGGTGAGCGAGAATCTCTGCCAAACGAAGCACGAGGAGGATCTTCCACAGCAGTTGTTATCTGTTG
CGAAGCACACTTACGGTTAGTTCGAACGAGTAGCATTCATAGCGAAGAAATACACGTACACTGGCGATGCCTGACAGCTTTAGAGCTCGAAAGGAATCCT
CAGATGAAACATAGGCCAGAGATTTCACGTCCAGAAAATGAAGAAGTTGAGCCCAGATCGAGCGGATCCTGTTTAGCCTGTCCAACATGCCATCGACAGC
AGCATTACAAGCTTCAGGCTTCGCCATTTTCGATGCTTTGAAGCGGATGACGTCGTTGACATCAACAAGAACTTCAAATACGCCTTCTCGCAGGCGTTCC
ATGCTGATATTTGCCGTGACATTGGGGACAATTCTTCTGTGTTCAGCCCCCCGGTACTTCAGCGATGCTCGAAGTCTGTTAATACCAGCGCATAATTCAT
CTGTTGGTGTAAACAGACTTCGAATTGCGGCGCGAAATTTGCCATCGTCGGTGTTCTCGCTCTCAGACACCTCATTATAGTTTTTTTTCATTTCATTCTC
AAAGGCTGCCTCATCTGCTGCAGCGCTGACATCTTGTGAGGCTTTGACTGCGGACGGATCCCAGTCATCATCAAACCCACCGTCTGAATAGTTATCGTAG
TCGTCGTCGTCCATCTCATCGTCGCTGCACAATACGAGATTAGACTTCTTCACTTGAGTTGTTGTCGGGGGGCGAGATTGGTTCGTTCCTGTGGATGTCG
ATGCTGGTGCTGCATTTGTTGTGTTGTTGCTTCCATTTGAGGAGCACGACGGGGTAGATACGGATATCATCTTGTTCAATGATTGCAGGATGTCGCGCCA
TTTTTCATTTGCAGACCGTTTGGCATCTTTCGCGTTCAGGCATGCTGTCGAAATGGCCAGTGTGTTGCGCACTCGAATGAAATACATGTACAAGGGCGGA
ACGAGCTTTTCCGACGCCGAAACCTGAAAGGACCTTGTGTTAGTCTCCCTTAGGGCCAACAATGCAGTACTTCGAAGTAGTTAGCCAGCCGTACCTTGTC
ATGATTCTTTGCTTGCGTTTCGTTGCCTGCCATCAAAGTTGTGGGCGTTTCAATTAGTCGTTCGTTGTACGTGACGAGCAACGCTTTCCACGTTTCAATC
ATCCCATCCAGTGTGTTTATCAAAACAGAAATTGCCTTGTCCTTCGCGATTTCAATCGACGACCCTTCTCCTTTTGCTTCGACCACGCCTTCGGATGCAG
AAAGCACACAGCTAACAAGACCACTGTTTTCCTTCGTAGCAATCCGGCGGATCTGGAATGCAATGTAGACATCACACTAAGTAAAACGTACTAAACTATA
CGAAGCAGGAAAAATACCTTCCGATACATACCGATAGATTGGACGAAAGCTGAATAGTTTCGGACTGCACACGCAAATTCCACACGATCGATCTTACAGT
TTGCTCGGTCCTCTCCCGATCTCGAAATAGGAACATCAGAAGTTCCTGGTAAGCGTCAGATTTTGCTTTTGAGGCTTCATCTTCGGAACGAGGGGGTCCA
TCACTATTGGCCTGCGAGCCGCTTCGATCTTCAATGAAGATGTTTGCTTCTGCTTCGGCACCAGAGATTCTCTCAGCTCTGTTTTCGGAATATTTCCTTT
CAGGAAGTGGTGGTATTTCGGATTCTGGGGCTGAGTACTCCAGTCGGGGACGAGGAGCACCACGCTCGTCCTCGTAAGTGTCATTTGCATTTGGTGCGTA
GTGTCGCTTTCGTAAAATGCCCATAGACCTTAGCTCAGCATCTCTCGAGCCGACATTTTCGCTGCTCACGCTGTTTTCGCGCATGGAATCCACCTCGCTG
TGGTTATAATATGGCTGGGCATCTTCAGTCGCGCTTGGCTCATAACTGCTGGTCCACGCATCTCCATGGTGGGGTTGAACACTTTCTATCTTGGTCGGTT
CAAAGTCGTTCGCATGGTGCTCTGCGCGGTCGAGCATCAGACTCTCCTCGTGCTGATCAATTAATTCCATCAGGAACAGCATCAGTGCGTCAACTGTCTC
ACTTTTAACGCTGGGTAAAGATGAACCACGCCTCCAAACGAGTGGGAGCTCTTGGATTAGAGCAACTACGTCATAGTTAGTATCGTTATCAGTGGGCTCT
GCAGTGGGTTTCTCGTACAGCTGCACAATCCAATAACTTATCAGTCTAATATCAACATGCCAGCCAAGCAAATGTGCGTACCCGAACAATTTTCTTCGAG
ATCAGATAGTTGAAAGATGCATCTTTCACCCTTCTGGTATCATTCGCGATACAGAGGCCGAATTGAGACTTCAGATGCAGCAGCATGCCGCCATACAGTC
TTCGATGTTCAACTACAGCCCTTGTAAGCTGCGACAAAGCTCGGATAGTTGCATCACGATCGACAGATGCAGTGCACTCAAATGACAAATTTCCTAGTCG
AACCCGAGCAATGTACTGGGCCGAATCAACCATCCGCAACTCTCGCCGAAGCTGCGCGGAAACAACCGTCAACCAAAGTATTCAGGGAATGAGGAAAACA
GAGAGCTTACCTTGAGTCCCGCAGCCAAGATAAACTCTTTACTCATTGCTGACAGCGACACAGTTTGGACAGCTTTTCCTAGTCCTTGAAGCGATGACAC
GAGGTCGATATTAGGGCCAACCAAAGCAAGGAGGTACGATCGGCCCTCCTCAACACCGAAAGTTCTCTGCTTGGCGGGGATACTTTTGTCACTCTGTTGG
CCCTGCTGAGTGGGTGGAGGAGGTAGAGGTGCTGGAGTCGGTGTCGGAGCTGAAGCTCTAGCGGCCTCAGAGACTGGCTCAGTCACGCTTACATGGATCG
GCGCGGCATCTATAGCAAAAGTCACCCGTTTCTTCGGCGCAGTCCGTGCGGCAAATTGAGAACCTTTGTGGCGCAGTATCGACGTAGTGCTCGGTGCACC
GGCAGGGTTGCTGTCATAGCTCTCGTCGATCGTATCGACTGCCATGTCCACAGGTTCCTCAGCCATGTCCACGTCCTTGTCCTTGTCCTTGTTTGCTCCG
TTGCCCACCCCCTGCTCACGCATCAATTCCGCATACCACTTCCGGAATTTGTCGGCGAATTGGAACTTCCTGTCCTCCATCAACGTGTTCCTCATGTCTC
CCGTCATGATCTTCACGTACATCAGCAGCTTCTTGGCCGAGTGTAAGCGCTGCACTGCCACTCGGTCCTGTCTGATCAGCCCCTCGTAGCGTTCAGCCAA
CTGCTGGTGGTGCGTGTCCATCTCGTCCAGGAGGCGGAGAACGCGACCAGGCGTGCGTCCCTGTCTCGGATCGTCCCGAGCCGCCGCCCCCATGCGTACG
AAGCGCAGCACAACCGTCCTCCTCGTCGCCTTGTCCTGCTCCTGCTTAATGTGAACTTGTGCCCCAATAGCAGCCACGTCCTTATGCAGCTGCTTGAGTT
TCCTGGGGCACAAGAGGAAGTCCTCGATGCCCATTCCCACGAAATAGTCGTCCGGTTCCACGGTGCAGATGGGCTCCAGGGCAGCGCATTTGCCCGCCAC
TTTGTCCTCGAACGCCATGGGAAACTGCGGCGGCGCTGTCTTCTGCACTTGGAACAGGTGCGAGCTCATGATGGCGGTCACTGACACGCCCATGCTCGCG
AGCTGCAGGTCGCCAACGGGCCCACGGGGAAGCGAGTAGTGCACCTCGAAGGCGCGGCCTAGTGACAGCAGCTTGCGAGCAGCGAGCGTCGTCTCCACGC
GCCACAGACGCACGCTCATGTCGAACGCCAGGTCTTGGTTGAGCTCGGGAAGCGGCTCCATGCTGTCCGCCCAGGGCGCCATGTTCCAGGCTCTGCCGAC
AACTGGATGTCACTGTGTGTGGCACTACGGAATGACTGGATTTCACTATACCAGTTGGTGCCAAGGGTGACAATGCTCGCGGCTTGTGTGTGTATTACTT
ATGTTAATACTGTCTACTCCATGAGGAAGATGCGGCTGGCAACGTCGCCGACGAGCCAGTCGATGCCGTCCACGAGGCCGTCGCCAGTGACGGCGCTGCA
CGAGACGATACTCCAGTGGCGGGTGGAAAACTGAGCCGACCGCAGCCCCAAAGCGTCTGCGATCTCCGCGGAGGAGAGAGCGCCAGGCAGGTCCTGCTTG
TTGGCAAAGATGAGCAGCGTAGCGCCTGCTAGTTTCTGCAAATACGGTAGCAGCCAGCAGTCAGAGAAGCAGCAACTTCAGGAGGATCTTATGAACGCAC
CTCTTGCGTCAGCAGACTCGAGAGCTCGCGCTTGCAGTCTTCGAGTCGCCGTCGATCGGCGCTGTCCACGACCCACACGAGGCCATCCGTCTGTCGAAGC
ACACATCCACTGTAAGCTTCCTTTATACTTCAGTGTATACAGCCTGCCGCTTCCAGACCTGCTCGAAGTAGTTTCTCCAGTACGAGCGAATCGTTTGCTG
TCCGCCGACGTCCCAGACATTCAACTTGAAGCTGGCAGTGACAGCAACACAGCGACCATGAACCTCGCACTTGCACAGAACCCACCGCGCACACTCACTC
TTTGTACTCAAGTGTCTGGATGTCGAACCCCAGCGTTGGAGAGATCTCGGTGATGTCCTGGCCCATGAACTTCTTCAGGATTGTCGTCTTGCCGGCGTTG
TCCAAGCCACTACAGCAACAGCAAGCGCGTCAGCCCCAGTAAACGACCTCTAGCACTAAGAGTGAAGATAGCAACGCACAGCATAAGGACTCGGATCTCC
TTCTCCTTCTCCTTGACCTTCTTGAGGATACTCAGCAGCCCCATGATGCGATTCGCCTTGGTGATCTAAAGTAAATTGCCGAACGGGAAGTAATTTATTT
GTAAACTACCGTCACGAAAGGGCATGAAACGACGCTTACGTTAGGTAGTTCAAGCGCAGCGCAATTGCAGTTAGTACTACGTAGTCGATACGCCATGACC
AAAGCCGCCCCACCTAGACGCTTACTGCTGAAGAAGTGCGATGGGAACCAGGAGGACGTAAACGCTTTCGATCCGAGCAGTCGGTCGACCAAGGCGCATT
TCCCCCTGCAACAGGAGCAGTCTTCAAAAGAAGATGCAGATCCGTTCGAGAGCAGAAGAGCTTGCAGACACACGTCATTGGAAGAGCTACTAGATCTGGA
ACTGGATTTGATCCTGCCTGTCACTGCAATTCCAGCTCCGACGAGCAACCAGTTGCCTGTTTGTGCTGCAAACGAGGAGCTGGAGGCCGACGTCGACTCC
GTCTCACTGGAGCTGCTGGTACGAACGAGCGAGCAACCATAGTCGTAAATGACAACTCACATGACTCGTATGTGTTGATGATGCAGGCGATGCAGAGCCC
ACACGGCGAGAATCAGCAATGGCTAAGCGAAGAAGACGAGCAAGACGCGAATTCCGTGCCAAGCGCGATCACCGTTCGACCAGAGGAACAGTCTCCACGG
CCTACTGTGAAAAGAGCGTCGGCTTCTAGAAAACCGATGGCGCTTCATCTCGTGTCGCCGACAGCGTTTGTACCATCGTTCCCTCCATCACCGAGCCAGT
CGTCGACAGACGAGGACTATGGTTTAGCATCGCCGATGGCGCTGCCAGACACACCTTCACAGTCTCAATCAGGGATCACTTTAACCTGGGACCTTGCACC
AACCTCTCCTACCTACGAAGATACTTATACAAGAGCAGGAACTTCTCGTGGATTCGCACAGTCCAAGAGCGTCCAAAGACCAGAGCGTCGAACCCCTCGA
TTTTCAGCTGCAGCTAGAGCTGCAACACCAAACCCACGAAACCACGGAAGCTATGCACCGGACCGAGCTACGGCACGGATAACACGGTCTGCACTTCCAA
CGCTACCGGAAGGCCGAGGCAAGGCTAGGCATGGCGGAATCTACTCATTGTTACTCAAGAATAAATCTGGGAAACAGGAGCCGATGCTCGTTGAGGACGC
ACACAATTCCGACGGTACGCTGCTGTGGTTTGATGGTACAGAGGAAATTTTTGGTACTGATTTCTATCCCTCAGATATGACTCAGGCGCCTTCCGTTTCT
AAGGCGAGTGCGTGCAAGCAAAAACACGGAGGTATCTACAAAATGCTGAGAAATTATAAATAATTTCTCATGTTATACACGGTTCTCTCGTTTTCTCTCT
TAACGCTATCCATAGCTCGAGTTTCATTTCGTGCCGACCATCCTGGATTTTGTGGATACACATGTTACCCGGTAATTTACCCTGTAATCTATTCTTTTTT
TTGCTTATTGCATCATCAAGAGAAGAGCGCACCGAGATGAACCGCATTTTCGGCAAGAAGAAGGCCGAGGCACCCTCCGTCAACGTCTCCGATGTAGGGG
GAAAGGTGGACGCGCGGATCACCGACCTCGACATGAAGGTAAGTGGCTGGGACTTGCGCTGCGGCTAATGAGCGCCGCTGACCGAGTAAACCCCAGATAG
AGAAACTGGATCAGGAGCTCCGGAAGCACCGGGAGCAGATGAAAAAGACGCGGGGCCCAGCGCTCAATACTGTGAAACAGCGAGCCATGCAGACACTCAA
GCGGAAGAAGATGTTCGAGGCGCAACGGGACAAACTGACAGCCCAGTCCTTCAATATTGAGCAGGTGCCTTGGACAGATTGACGGGCGTCTGATGGGCGT
CTGAGGCTGGTACCGAACGCTGATCCTGTGCGTGTATGCTCCGCTATCGAACTCTCTGGATTGCAGGCCTCGTTTGCCATTGACACATCAAGGGACACAA
TCTCAACTGTGGCTGCCATGAAGAGCGCAGCGGTGCAACTGAAGGCAGAGACACAGAAAATCGACATTTCCGAGCTGGAGGTGAGACTGGCCACATTAAC
TATGTTGCGTATAGCGAGCTATTTGCTGATGCGCCCTGTGCGATTATGCGTGGAGCAGGACGTGCAAGACGACATGGCGGATTTGATGGAGGATATGAAC
GAGATCCAAGAGATCATGGGGCGCTCGTACGGGTACGTACTTGCAGCACCTTATCACTGCTTGCCTGAAGTCACAATGCGAGCATATCTGACCGTGTGAT
GTTCGGGCATTTTTGCCTATCTGCAGCATCGGCGACGAAATCGACGAAGACGAGTTGGAAGCGGAGCTGGAGGGGCTGGAGGAAGAGTGGGCTGAGGAAG
AGGCGCTTGGAGAGGAAGCAGAGTCGGCGCCGTCGTACCTTGCACCAGCCCAGCACCACGAGCTGCCTGCCGCCCCCTCGGGCATCTTAGACTCGGGTAC
CACAGCTCGCGCTACCGACGAGTTCGGGCTTCCCGTAGCGTCCTACTCTACGTAGCGCTGCAAGCTGCACACCCAGCAAAACACAAGACCTTACCAATAC
ATTTGCAGCACATTCGCAATACAGCCATGTGTCATTGCGCAGTTCGTGTCGCTGTCAGCCAAGCGTTGGATCGTGGCCACGCACTTGTCAAACATGGACC
GGGAGAGATGGCTACATTATACCACGTCAGCGGAGCTACGCTATTGGCCGAGCTTAGACAGCCAATCATTTTTCGGAATCACGTTTGACAGGGTAAAAAA
TGAATATTACAGGATATGTATTATCACAAGGTGGTCATTGATGTATTTGTAAAGCAAGTGTATCTTTCCCTCGCACGAATTCGTTTATATCATTCGCGAG
GTTTTTTATCCCCGAGGTTTTATCATTCCAAGCAAAATTTGGTTGCGCTCACTTTGGTATTGGTGGTTTTGGCAGCGCTTCGTCCAGATTCCAAGCAGCA
GTCTGGCAGGTATGGCCCGCGAAAGCAAAGGAGCCGCGCGTGAAGCGCGAACGCAAGGGAAAGAAGGAGTCGCGCAAGAAAGCGGCCGAGGAGAAGAAGG
CTGCCGAGAAGGCCGAGGCGCTCGAGAACATGTCGCACGCCGACCGCTTGGCCGAGGAAGGCATCATCGCCACGTGCTCGCACAACGTGCGCTCGGTTCA
CAAGAACTTCAAGGACATCAATGTGCTCAACTTCAGTATCACGTACTTCGGCAAGGTGCTCATGGAGGAGTGCGACATCTCGCTCAACTTCGGCCGGCGC
TACGGCCTCATCGGTCGCAACGGTTCGGGTAAGTCCACCTTCATGAACGTGCTAGGCGCGCGCGGTATCCCCATTCCGGAGAGCATCGACATCTACCACC
TTAAGCACGAAATCGAGGCCAGTGACATGACGGCGCTCGAGGCCGTGCTCTCCGTGGACGAGGAGCGCAACAAGCTCCAGGCCGAAGCTGACGCTCTCTC
GGAGAAGATGACCGACGATTCCATCAGCGAGGAAGACAGCGAGGCCATCTCTGACCGTCTGACGGACCTGTACGAGCGTCTCGATGACATGGACGCCGCT
ACGGCCGAGGTCCGCGCTCGTCAGATTCTGTCGGGTTTGACGTTCTCGGACGCCATGATGGAGAAGAAGACTAAGGAGTTTTCCGGTGGGTGGCGTATGC
GTATCGCGCTCGCCCGTGCTCTGTTCATTCAGCCGACCCTGCTGCTGCTCGATGAGCCTACCAACCACTTGGATATGGAGGCTGTCGTCTGGCTGGAGGA
CTACCTGTCCAAGTGGAAGAAGATCCTGCTCATGATTTCGCACTCACAGGAGTTTATGAACGAAGTCTGCACGAACATTATCGATCTCACCAACAAGAAG
CTCGAGTACTACAATGGTAACTACGACACGTACGTGCGCACCAAGGCTGAAAAGGAGGAGAACCAGATGAAGCGTTACAACTGGGAGCAGGAACAGATCA
AGCACATGAAGGAGTACATTGCCAAGTTCGGTCACGGTTCCGCTAAGCTTGCCCGTCAGGCTCAGAGTAAGGAAAAGACGCTGGCCAAGATGGTGCGTGA
CGGTCTCACGGAGAAGGTCGAGCAAGAAATGATCGGTGACTTCAAGTTCCCCAACCCGGAACCGCTCCCTCCTCCGGTTCTCATGTTCCAGAATGTGGCT
TTCGGTTACCCGGATTGCCCCCTGCTATACTCCGGCGTTGAGATGGGACTTGACCTGGATTCCCGTGTGGCTCTAGTCGGTGCCAATGGTACTGGTAAGA
CAACCCTTCTCAAGCTTATCACAGGAGATCTGGTGGCGCGAGAGGGTAACGTCCGACCACACAGCAAACTTCGCATTGCGCGATTCAGCCAGCACTTTGT
GGATGTGCTGGACCTGACGAAGACCCCGCTTGAATACTTCCGCTCGCTCTTCCAGACGAAGTCTGTTGAGGATGTCCGTAGCTACCTCGGCCGCTACGGC
ATCACCGGTGAGGTGCAAACACAGATCATGGGTCAGCTTTCTGACGGACAGAAGAGTCGTGTGGTGTTTGCGTACATGGCGCAGCAGAATGCACACATGC
TGCTGCTGGATGAGCCCACGAATCACTTGGATATGGAGTCTATTGATGCACTGGCTCGCGCTATTAACAACTTCGAGGGTGGCATGTTGCTGGTGAGTCA
CGACATGCGATTGATTTCGCAGGTCGCCAAGGAGATTTGGCTTGTAGAGAACCAGTCTATCAAGGTCTACCAGGGTGAGATTTCCGACTTCAAGATGCGC
GTGCGTAAGCAGCTCAAATTGGCGGACAAGGAACCTGCCAAGGGTGCCGAGTAAATGCTCATGATAGCTTTCTTCTCATTAGATCACCTCTACATGTAGA
GCTGTTGAGGCAACCGCTGAAGCATTTTCTTAGCACGCTGTTCTGTTCATATTTGATTCCCTTGCCGACAGATAACATAGATTGAAAAATCACACGTTGG
TAGTTGATGAAGTT