Description :
From Genome Similarity Track
Location :
Scaffold_45:196325- 199678
Sequence
3353 bases(100 bases per row)
ACAGCTGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAAT
CGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCCAAGTACTCCACCTTGCGCATCCCCCAATAGCTCTTTAC
CACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCG
ATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTG
TTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCA
CTCGAACAGGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTT
TATCCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATAT
CCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGA
TAGTTTTTCCCGGAACTGAGGTGACACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGC
GGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTT
GGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCACAGATCTTCGGCGTGTAGATCCCCGCCTTCACG
GTAACAGACTTGCTCATCTTCCGTCTTCAGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTCTATCCTGCAGTCCTTCTATCTTCGGGGGTTCT
GGTACCCTGGTATCAGGAAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACGGTTCGGGTTTGACTAGTGTTGCCACTCTCGATA
GGGATCCAGGCACTTTATCCAATGGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGA
CCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCAATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTT
CGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACA
CCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATA
ATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGA
GTGACCCACTGTTTCTCATGTTCCACCCACCTTAACCGATCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCC
TCATCTTCGCCCCATACAACGGTCGTCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCACTAGATCCAACCTCACTCCGGC
CGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACACCAAACAACCTGTTAGCGTGATCTTG
ATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCTCATCCACTTGGCACCCAACCTTACGAGCAAAGG
CGGTATCCTGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCC
CGGGGCATGGTACTTCCAGTACCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCATAGGATCCAGTGACCAGACAGACCTTA
GGTGGATCTGCAGTGACTTCACCTTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCAATAACCACGTGCCGCTCCCCTTTGTAGATCCAGGG
TTGAAGAAACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACCAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATG
TAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGT
CCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACA
CTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCTACACTTCTCACAGACCAGATGTTTC
CAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAGCACCTGACCTGGGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCC
CGGGTACGGTATCCCTCGGTCGAGAATTGTCTCCGGTCTTCGCCGTTCGATCGTTGGGCGCAGTGAGACAGACTCGACGGTAATCTTCAAGGTCGGAGTC
CGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTT
GCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCATCTGCGTCTGGAAGACGTAACTAGGGT
CAGCCTGTCGGCCAGATCCACATCTCCCTACGTCTCGATGAGTGATCCACGTG