Description :
From Genome Similarity Track
Location :
Scaffold_1093:1963- 3714
Transcript NameFunction/comments
Phyke_g11963hypothetical protein PHYSODRAFT_311407
Phyke_g11964heat shock protein 70

Sequence
1751 bases(100 bases per row)
TTAATNTCGAACTCCTCCTTCTCAGCGGACTGGTTGGCGTCGAGCCAGTTAATGGTCTCAGTCACCTTGTCGTccaccatcttcttgtcgGCCTCGGGGA
TCTTTTctttcagcttctcgtcATTCAGGCTGTTGCGTAGGCTGTACGCGTAGTTCTCCAGTGCGTTCTTCGCCTCAATCCGGATCTTGTTAGCCTCATC
CTCTGACTTGTACTTCTCAGCCTCCGCCACCATGCGGTCAATGTCAGCCTGCGATAGACGACCCTTGTCGTTCGTGATCGTGATCTTATTCTCCTTGCCC
GTAGACTTCTCGACAGCAGACACGTTCAGGATACCGTTGGCATCAATGTCGAACGTCACATCGATCTGGGGGACACCACGAGGCATCGGTGGGATGCTGT
CCAGGTTGAACTTGCCCAGTAGGTTGTTGTCCCGGGTCATCGTGCGCTCACCCTCGAACACCTGGATCAGCACACCAGGCTGGTTGTCCGCGTACGTCGA
GAACGTCtgcgacttcttcgtggGCACCGTCGTATTACGCGCGatcagcgtcgtcatcacaCCACCCGCGGTCTCCAGACCAAGCGACAGAGGCgtcaca
tccagcagcagcaaatcctgcagcttctccgACGAATCGTTGCCGCTCAGAATGGCCGCCTGCACCGTGGCGCCGAACGCCACAGCCTCGTCCGGGTTGA
TCGACTTGCACGGCTCCTTGCCGTTGAAGAAGTCcgacagaagctgctgcaccttcgGGATACGCGTGGAACCGCcgacaagcaccacctcgTGCACCTG
gctcttcgacagcttcgCGTCGcgcagcaccttctccacgGGCTCCATCGTCTTACGGAAGTAGTCGCCGCACATGTCCTCGAAACGAGCACGGGTGATG
GTCGAGTTGAAGTCGATACCGTCGAACAGCGAGTCGATCTCGATGTAAGCCTGGGCAGACGATGACAGCGTACGCTTGGCGCGCTCGCAGGCAGTCCGCA
GACGACGCAGTGCACGCTGGTTCTCCGTGATGTCCTTGCGgtgcttgcgcttgaacTCCGACACGAAGTGGTCCACCAGACGGTTGTCGAAGTCCTCACC
ACCCAAGTGCGTGTCACCCGCAGTCGCCTTCACCTCGAAGATTCCCTCCTCGATGCTCAGCAGCGACACATCGAAGGTACCGCCACCCAGGTCGAAGATC
AGCACGTTACGCTCGCCGCCCTTCTTGTCCAGACCGTACGCAATCGCAGCAGCCGTCGGCTCGTTGATGATACGCAGCACGTTCATGCCGGCAATGGCAC
CAGCATCCTTGGTGGCCTGACGCTGCGAGTCGTTGAAGTAGGCCGGCACCGTGATGACGGCGTTCTTCACCTCCTTGCCGATGAACGCCTCAGCCACCTC
GCGCATCTTGATCAGCACCATGGACGAGATCTCCTCCGGTTGGAACGTCTTCGATTCGCCCTTGAACTGCACCGTGATCTGGGGCTTGTCACCGGCACCC
GACGACAGCTTGAACGGCCAGTGCTTGATGTCCGACTGCACGATTGGGTCCGAGAACTTGCGACCGATCAGACGCTTGGCGTCGAACACCGTGTTGTGCG
CATTCATGGCCACCTGGTTCTTGGCGGCGTCTCCGATCAGACGCTCCGTGTCCGTGAAGGCAACGTACGAAGGGGTCGTACGGTTACCTTGGTCATTGGC
GATGATCTCCACACGGTCATTCTGCCATACGCCCACGCACGAGTATGTCGT