Description :
From Genome Similarity Track
Location :
Scaffold_71:19629- 21356
Transcript NameFunction/comments
Albla_Nc14055700autophagyrelated protein 7 putative

Sequence
1727 bases(100 bases per row)
TCTTTCTCATCCTCACTATCCTCCAACACATCAAATGCACTGAACTCTGCTTCTTGAGACAATTTATCCAGACCTGTCAATTGTTCCAAGTACGTCGATG
AATTGCACGCATTTTGTAGTAATTCGAAAGAGTTGGAATGAAAAACGTTCAAGACCGTGTCACTGCATGCAATACATTTGTCAAAAGGCGCTCCGACGAC
CGGTACCACATTGAAGCTGTTTAGATAGCCACGAAGCTGATGGGGAATATAGCCTAAAGCCTCTGAAGATTGTGATACGACGTCTCCTCTTCCACGCTCT
GGAGAATGTAATAATGCGACTAAAAGCTCCACAGCATTCGCCGAAGCTATCGGAGCCACTCCAGGGCGCGTCACTGTACACATTTGATCGAGTGTGCGAT
CGCTGAGAGAATTTCGAGGACCCACGATATCATTGCAAAAGTAGCAGCCTAGATTGACACTGGAGGTCCCGTCGGAATGCTCTGTTCGAATTCCATGACG
CATGACCAAATAGCTATCGAATCCCAATGCTGCATTGATGACGATCTTTTGCTTTGCTGCACCAATTACTGTTGGGAGCCATCGACTCTCTCGTGAATCT
GTGCCAAGGAATATCACTTCATGCGTATCGATGAGAAATTCCAGTCGATCAAGTCCTTCTTTTGCTTCTCGAACCAGCTCACTGTTGCTTAAAGCGTGAC
CAGCCATAGGGATATTGAGAGCTTCTCCTTGAGCATTTACTAATGGAAATATTCGCTTCAGGGCGTTTGCTGCGCATTCTGCTTTGGGTTTTCCACAATC
CTGAAACTCATATAAAGGCTGACGAACGGGATTGGAGTAACTAACAGTAGAATTGTCGACGAGAGTGATGTGTCGAAACCCCCAGGAAAGCAAGCTTCTA
GCTGTGAAGCATCCAAGCGTCCCAGCGCCTAACAGTAAGCATTTGTTATTCGCAATCAAATCGAGTTGGAGTGAGGGTAATTGACGCCATCGCATCAATT
TCAGATTGAGATCAACTGAAGTCTCCGCAAGACGCAAAGGGTCCATCTGATTGCTTAGATCCATCATTCGAGGTCCGTGCTTTCGTCGTTGATTACATTC
CCATCCGACTACCCCAATATCTATTGAGTCGCTACTCATTCGTTGTGGTATGCATACGTGGAAGATCAACGAATTTGAGAATGTCTCGAATTTTAAATCG
TTCTCACAGCCTTGCATTCCATGTTCTCGGAAAGAGAAGATTTTCAACGGTTTGGAAATATCAACCATATTCTCGGGTAACATGCTGAGGAGTGCTAGGT
AATTGCGCAGAGGCCAGCCTGGATGAGAAGGCAGGGCACAAGGATCAACAAAACCGTAGTATTCTTCGACTACCGTGTTGTCCATATCGACTTGCTGCTG
TCGCATCTGTTGGATTCTCCAGGTGCAAAAGTCAAGCACTTTCACATTCGTATCTTTCGCATCCGATTCTCGACCTCGCGAGCGTTGAATGACGAAGTAT
GGGACGATTTGGTCCTTAGTTTGATGCTCTCCGTTCGCAGATTGCGACTGCATCAATTCTTGGATCACAGCTCTTTGCTCATTCTGCGTAAATTCCGTGC
TGGCTAGATTCGGTGCCTTTACTTTTTGATACGGACAGGATGGAACGAGTGCAGGGAAGGCGAACCAGTACAGAAATGTATGCTTTTTGAGTTCTGCAAA
GGTACACAGAAGAAATCCATTCAGTTG