Description :
From Genome Similarity Track
Location :
Scaffold_107:196198- 200838
Transcript NameFunction/comments
Hyaar_Emoy2809699calmodulin-binding transcription activator, putative
Hyaar_Emoy2809700conserved unknown protein

Sequence
4640 bases(100 bases per row)
TCTGCGACACTGTGGGAATCCCTATTGCGCTATTGACCGCCGCATAAAACCCACGACGCTATAAGACGACGAATGAACCAAGCGCGCGCAGCCTTTCTGT
GCAACGAAGCGACGCGACGATGGCTCGTAAAAGACGAGTTGGTGTTCCTCTTGTTGCACTACAAGATGGTGGCCGTCCCGCTGCTCCGCTCGGTGCAGTT
TCGACCACCAAGTACGTCTGCCGTCGCATGGTTGAATAAAGGAGCTTTTTGACGATTTGAAACTTATATGAGTGATAGATTCACCCTAACTTATGGTACC
CTATTGATTCGTGTTCAGGCGGCACTTTGTTGTTCTGCAATACACTGGAGGTATCGGACTACAAGAAAGATGGCTGGCATTGGCAGAAGCGCAAAGACAA
GAGTGGACGGGTGCGGTGATGGTTCTTGTGTGGTTATGGCGTGCTGTTTGGTTATGTTACTAATAAATGATGTGACTGCCAAGTTGTGCTGACTCCTGCT
TATGTATGACGTGCAGGTTCGTGAGGACCGAGCAAAGCTAGTGATTAACCGAGAGGTCATTGTCTTGGGAACATATGTGCATTCCGCCGAGATTTCCGTA
AGTTGATTCGTTACAGTACAAAATGGAGGTTTGTACATATAAATTTATCCAGGGTACTGGTGTGCTGTTTACGATGAGCTGCTTGTAGACATTTCATCGA
AGAATCTATTACATGAGGGACTCTATGAAGAACATTGTACTTGTTCACTACTTAGACGAGATGAACAAGGGATGCGTGGGATGTCCAGTGTCGACATATG
TAACCAAGACGCGTAACGAAATAGATCGGTCGTTATCCGTTGCTACAGTATCAATGCCACCATTCCAGCGACAATATTCACAGAAACTTGTGTCGTCCGA
CAAAACAGAAGGGTCTATCATGGATGGTTCGTAGACGGTGTCTATATGCTTCCGGTGTTTTTGTGTTGATTTGACCATCGGCCTTACGTTGTAATTTCAT
GTCTAGGCTGCCTCGGTGTGGACTTAGGGTCCCGAACGACGTTACGGCGGACTGCGTCGATGGACTCTTCTGATGCGATTTCTCCATCGCTGAAGGGGGA
CAGCATGGACGGGATCAACACAGGACTTTGTGCAGACGAACAAACAAATGACCCGGATAGCCTCATTTCTTTAGGAGAGCGCAACTCGGGCTCGGAAGGC
CGGCGCACCTTCAAGCTGGCTGAAATTTCCGATTTCTCACCCGACTGGGACTTCGAAGATGGTGGGGCCAAGGTCTTAATCTGTCTTGCAGCAAATCTTC
CAAAGAGTGTGGCACACGATACCATGAATTTGTTTGTGCAGTTCGGTACCAAACGAACTCGCGCAGAAATAGTCTCGGATACAGTCTTACGTTGCATAGG
TACGTATTTGGGCTTATCATGTTCCCTTGTAATTGGCATTCACGTATGATACAACTTGTTGACGACACGTTGCTGCACTTCATATTGATGCAGCTCCTAG
TTGTACAAATCCTGGTAGTGTTCACATGTACGTGTGTCACTGGCGTGAAGCACTGCAACAGGAAGCTTTCCAACTGTCGCAGCGAAAAAAGTTCACCTAC
CGAAGTTACCGCTGGGCGTCCCCATCACTGGTGGGCCAAGTAGCTAAAGATGAACAGGCTATTGACCTTCCCGAAGTGTCAGTACCTCGTGCTGTACACA
GCGCCTCCGGCATGGGCAAGCGAAGCCGAACTCGTGCTGTTCATTCCTCTGCCGGTGATGAATGCATACGGCCGCTGAACAATGTTTTAGGATCGAATCG
ATCATTGTCGACATATGTCGAGTCGGATCGTAAGTTTTTATGCCACTGTTTGCTCAGTTACCACTTGCCTCAACGGCTTATGCTTTGTCTGTTCGGTATG
ATGTGTGACCAGTGGACGAACGACAGTGCAAGATCCGAGTCGTTGAGCGATTGTCCGAGTTCCACCAAGTGATACAGACCAAACCAGAGGAGTCTGCAGT
CGGGATTATCGATTCTGGTGTCCCAGGCAGATTTAGCGGTGAGGAAAGTATGTTTGCAGATGCGAGAGGCGGATCGATTCTACGTAGTGAACAACCTTCT
GGAAGGGTGTGTTCATCGTCCTGCCAAGAACAGATCTCGAGTGAGCACGTTCCTCAGTCAAGCTCACGTGTCGGACCGCCAGTCTCATCAACTTCTTTTG
GCGCAACATCGACTTCTTTGGACGACTGTGCAATCGAGGCCCTGAGCGACAATGAGTTGGAGCAGCTTTCCGAGAAACTACTGGAGCGTGTCGTGCGTCA
GCTTGTAACAGTTGCACATACGAGCGAAGAGCTGCTGGAAGAGCTCAACTCACTTGATGAAGCTGGCTTGAGCTTGCTGCACTATGTGAGTTTCTACAAT
TACTCTCAATTGGTGCTCCTTCTGCTTGCTCACGGCGCACAAATCAACCAGCAAAGTACTCAAGGGCAAACGGCGCTTCACTTAGCAGCAGGATGTGGTC
ATGACCAAGTGATTGATGTGCTGCAGCAGTCTGGGGCTGATTTACAAGTCCTCGATTTCGAGGGCTTAACTGCTGCTGATCGTGCTGATAAATCCGGTCA
CGCGGACGTTGCAGCCAAACTGTATCGCTGCATGGGAGATGGTACTCCTATCGACTCGGGTGTCACCGACGAAATATACGGAACGCTGATGGAGATAGAT
GACATATCGACACCCTACATGGATGCAGGAGACATGGGTCTCTTGGAGAGCATTGAAGACTCCGAATTTTCCGTGGGACCACCTCATTTGTACCCGAATA
GTTGTGAGAGTCCTTACGGAGCAAGATTACCGTCGAAAACGGTCTCGCGCGTAAGTGGCCATTCTGTACTATCTTGTTGAGCTAGATCGGATCGCTCATT
GGGTTTTGTGTGCTTCGTTACCTTGCAGATAGGAGAAACGCAGGAACACAACCGTAAGCTTCTGCTTGGGGCTTTTTCCACGATGAGCTTACATGACAAG
TGTGCTTTATCGTTGAGCATTTCACGAGAATCGGCGGGCCACGCGGCATGGCGCCGTGAAAGTATTGCGGAGGAAGACCTTCTGATCTCTTCAAGCACTA
GCAGCTCAGAGGTATCGGCGGGTTTTGGCTTCTCCAAAATAGCTAGCATGGATGCTGCTGACCTTGCCGACGGGCACTTCGTCCTACCCAGCCCTCAAAA
TGATTCGGATGTTCATAGTGTTATCGCTGATAACGAGGAAAGTTTGAACAAGCTCCAAGTAGCCATGGAACTCATGGGTCCAGAAGAGAGACAGTCGCTC
GAAGACGAGGTGAAAGTGCTGCAGCACGGTATACGCGCGTGGCTGCTCAAGCGGAACTGCAGAAACATGCGTGAGACGACCATCCAGCTTCGTGAAGCCA
CGCAAAGTATCAAGCAGCAAGAAGACACGGAGCACTTTCCTACAGGGACAAACAAGCAGTCAGAACGTGAGCGTGCCGCCATAACTGTCCAAGCCGCGAC
GCGGACCATGTTGGCCAGACGTAGTTTCCTGCAAACGAAGCACGTCGCAATTAAGCTACAAGCCGCCACACGCGGAGTGCTCTGTCGCAAACATTTTGCT
CGGATGAAGACGCATGCTCTGGCCTCACTGGTGATCCAGCGCAATGTTCGTGAGTGGTGGAACAAGCAGCCGACTGCTGCACGATCGGAAGGTTTTGGCA
ACAAAGCAGGCAACGTAGAAGAAAAAGATGACGACACAAAAGATGGAAAGTCATCGAGCTCACCTGACGCACATGAACGAGCGTTGTGCAATGAGTCGTG
CCACAATTTGTAACCACAGCACAATCTGAACATTGTAGCATAGCCCAACCTTGATACAGGCCTGTTCGCTTCATCTGAGGGTCTATTCGTCACTCACACT
CTGTCTCTCTGCAAACCAGCGGGCTGTAACCGGCATGTCTGTCTCTGACGAGCCATCCATGTACCTGCTTTAGCCCGTTGTTTCCTCTCCTTCGTCCGTG
TATCGTCTGAAGCCCGGAATCGGCGGCGTCCATGTGGCCATGGTACGTTCCTCCGGAATAGGAGCATCATCGATCTCCATTGCTTCTGCCTGCAGCTCTG
CAGGCAGTGCATTGATGGCTTCCCATTTGAGATCGATCTTGGTCTGCACGTCGCGCATAAAGTGATTGTGCTCAATCATGCTCATAACATTATAGCGGCG
ACCAATTTCTTGGTGGCGCTGCTTCTCTTCTTCTGTCCACTCCTCCCTGTAATGTAAATATAAAATAATTAACAGCCAGAGCATATGCACAATTAAATTA
ATGTAAATGTAAGTATGTATTGCAATAGTACAATATACTGACAAACGAGGCCTAGCATAAAACGTACGCATCCGGATATTGGCCCTTAATCGCACGCAGC
ATCTGCTCAAAGTTGGCATCGTCGTTCCCCTTTTTCTTGCCCTTCTTTTTATTCTCGGGCTTGGACGCAAAGCTACGCATACTAGCAGACGACGCAGTGA
CGTCGAACAGCAGAGTACACACAGCCGCCCGCTTAGCGGCCACGGAGGTGAAGCTGACCAGAGCCATCATGTTATTTGTATTTTTTGCTTCTATTCTGAG
CCAGTGAGCTGCTGTTAAGTACGGTACAATATATATTGTG