Description :
From Genome Similarity Track
Location :
Scaffold_257:19617- 22927
Transcript NameFunction/comments
Physo_144766pol protein

Sequence
3310 bases(100 bases per row)
TTGTCTGTCGCAACTTCACATCGTTGGGCACGACAATCCGTGGAGCGTCATCTGCAGGCGTTTGATACCACAGTAACCCGTTCGCTTCGGAGTAGCAGCG
GTATTTCTTGTGCTGCTGGTGTTCGCGCTTTGGTTTTGAGTCGGATTTGCGTCGCTTGATTGCTGTCAAGATTGCTTGGTCATCACGATCTTTCTTGTAC
GCTTTCTTGATGCGCGTAATCAGCTCCGAGTCACCCGTTACTTCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGTACGCTTGGAGTCAGACCTCGGCTTGAACCGTCCCT
TGCCGCGGAAAGGTTTCCCTTTGAATGACTTGTCTTGCTTGGGAGCTTGATCGGCGAAGATCTTCCTCTTGTCTTGGCGGGACTGGCGGTCGCGCACGTC
GTCCACAAAGTGCGTAACTTCGTACTTGATCGCCAGATCCATAGCCGCGCTCAGCGTCTCTGGGTTCTCGAGCTTGACGTAGTTACGGGTACGAGGCTTG
AGACCGTTTGCGTAGCTTAGTACCTGGTCAAGTACACTCATGCCCTCAACTCGGAAGATAAGAGCAGAGTATTCGCCGTTGTAGGTCTCGATGTCCGCCG
TTTGCTTGAGTCGCTGCAGCTTTTCTCGCAAGACGGCCTGGTAGTTCGAAGCTTCGAAGTGTTGGAGCACATGCTCACGGAAAATCCCCCACGTGTGCTC
CTCACTTCTCGTCGTCGATGACCAGTGCAGGAACCATCCTGAGGCCGGCTTTTCCATCGCCGACCCGGCGATACCCGGCAGACGCGCGCTCGCGTCTTCG
ATTTGGAACAGCCCTTCGCGAACGTCTTCCCCCCGCTTGCCGGTGAACTTGGGCAGATTGGTGGGCACTCGCGTGCGCTCTGCCATCGCTTCATTCAGCC
GGTCGATCTCGGCTCGTAGCTGGGCATTCGTCGGCATGGGCTTCTTGTAGTCAGGTTGCTGGGACCAACAAGTGCTACCAGTTTAACAGGAAGAAGTGCT
GTCTTGGGGGAGGGCATGCGGAACTAAGAGTGCCGCCCCCACAGTTCAGGCGGATGGAAGCTTCGCGAAGCCTCCACAGCCGCCCTACATCTGCATATCT
ATTTTAACTTGGTTTCACTATACCTACGGTGAGTCGTACCTACACTGACCTCCTATTGGCTTACCTTTCTACCAATCAGATACAATGGACGTCAGCTGAA
GCGGTCACTTGCCCTGCCTCCAAGCTTCGTGCCGTCGGAGCAACGCGTCTTCCTTCCCGGCGTGCAGGGCCTGGCTGGCAGCTCGGCCCTGCTGGGCTGG
ATTGAGTCAGGTGAGTCAGCACTGCCAGCAGGAGGACGCACTGCCCAGCACGCCACGTACGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCACTGCCTGGCTGCCTGCCTGGCAG
GTTAAGCGAGCCCGCCACCCACTCATTCATGCGGCGGCCCCGCTCTTGGTCGCTCCGGCCGGCTGGGCCGCTTCAACGATGCCCGCAAGCCCCGTCCAGA
CTCCAGACTC