Description :
From Genome Similarity Track
Location :
scaffold_5:196156- 198681
Sequence
2525 bases(100 bases per row)
TACGACTTTAGCCTAGCCACATAGAATGTAGGATGTAGGCGCATGCGTGTAGGGATAGCTGATGTATACGCATTACCAATGCAAATCATCACCTTGGACG
GCCCTATGAACCTTGTTAAAAGCGTCATGCTTCCCAAATTGGACAGTGCATGTTCAGGCAGATTTGTCGTGGAAATTAGTACAAGATCATGGACCTTATA
TGCCTTCTCGTTCTTCCTTCCGCTTCTATCTGCTTGTTCTTCTTGCAGCTTCTGAGCTTTCGCAATTGCGTCTGGAACAAACCGAACAATGGCTTGTCTC
ATCGCAATAAAGTCATCGACGCGCTGTTCATCACGAGttgtcatgtcgtctagCGGTCTCATTAAGTCAAAACTCGCTTTAActctgtgacagcatttag
gTCCGACTGTGGCTCTCCCTTCTCCACTAAAGGTGAAAGCCTTGCCCATTATGGAAGCAGGTACTCTAGGATAGATACCATAGTTCATATCAAATGGTGA
ATGACCTGCCGAGGCATGCGTGGAGTTGTTCGACGCAAACTctgcaagaagaaaaaattgagtCCACTCTCTGAACGACGAAGCGTAAGTAAGCAGTACG
TCTTCCAGGACTCGATTCACACGCTCCGTTTGAATGTTCGTTTCGGGGTGTGCCGCTGTTGACGTGGACAATTTGGTGCCCAATCGTCCAAACAGTGTAC
GCCAAAATTTCGACGTAAAACGGGTGTCACGGTCAGACACGATCCCAACAACAAGGCCATACCGACGTAAAACAACGTCTACGAAGACCTTAGCTATATT
CTTGGCTAAAACCTTGTCCGAGACTggcgcaagatgaaccatcggTCCAATAACACAAGGATGCCACTGCGTCCATGTGTGTCACGCGGAAGTCCGAATA
TGAACTCCATACATACAGACTTCTAGCTGCCACTTGGCACTGCCAACGACTGAAGTGGGGCCTGAGTGGAATAGGATGGTTTCACTCTCTGGCAAATCTC
ACAAGTTCTCCCATACTTGCGCAACCACTAATATATATGTGGCCAATAGTAATCCCGGTAAAGACTGAGAAATGTTTTCTCACGTCCATGATGGGCACCC
GAAGCGCTGTCATGGTTCTCATATAAGAGACGATGACGCAAACCTTAGTCATTTGGAACAACAACTCTTGCTGTATCCCCGTGTTCAACAGCAAAGTACA
ACAATCCGTTGTTAACTCCAAAACGGTGAACTCGCGATCTACGGAAGCCGTTGCAGTGCTTAGTCGGAAGGGTTATTGAAATACCTCAACAAGTtctgac
atgtctcatcagACTTGTACCCTTCGACAATCTCTTCGCGCACTGTAGTCCTAGCTTGCACTCTAATCGTCTAAACATCTTCgtattgtcgacatgactc
gtgcatgttttcgctttaaaatttggatcatagtccggtcgtcttgacaacgcatcggctAAGATGCTCGTCCTGTCTGGCTTGTAGTATACAACAAAGT
TatactccgcaaagaaggaaatCCATCGAGCTATTCTTTGCGATGGATGAGGAGTCTTTACTGCCGTAAGTAGTGAGGCATGATGtgtatagatcgcaaa
gcgcTCATCTCCAAGCAAATACAACGAAAATCAACcgaagcatacttcattgataAAAgctcttgtcatgaactagaTAGTTCCGCTCCGCGGGCTGGGG
ATGTCGCGACTGATACGAAAGAACTCACTCTCGATTCTCATCATCGCGTTGCATCAACGCACAAACGATGGCATAATTACTCGCATCGCAGACCACATGA
TAAGCTTATCGTGGTTTGCAATCgcaagaagaagagcttCTCTCAAGCATTTGTTCACTTCGGCAGTTACCGCATGGTGATCTTTTGACCATTCCCACTC
ACCgttcttttttttaaaagagTCGTAAGAAGCTGCACCAACGCTGCATATTTGCgcgtgtatttgtgcaagttgttggCCAAGCCCAGCCACTTTTTCA
GCTGTTTCACATTGTTCTGCACAGGCCAATCATTGATAGCTTTGGCTTTTTCCGGATACACGAACGCCATTCTTGCCCCAAAGCAGCCGAGAACGGGAGC
GGGAGTCTCTGATACAAAACAGGCCTTTTTTGGAGATTAGCGTAGAGTTTATGCCCTCGCATAACTGGGAAGACTTGAGGAAgatgaccaagatgacctt
CGGTGTCAGACTTCTCATCCACTTTCTTACTTGAtcgaatatatcgtcaaagcGACTCGGTGCAAATACTATCAATGGACAAAGCAGATTCGTAAGCATT
CTGTTGAAAGTCGTGGGAGAATTCTTCacaccttgtggcatcacttATCATTCTCACAGCATACCACTGGAGGTTCTGACTGCAGTTAATGGTGTATCAC
TTTCGCGTATTCGTTTCTGTTAAATGCCATCTTCGAATCGATCGCAGTGAGAATAGCACTGCCAACCATTCCAAATTATACCTTTGCGTGGAACCGGAGT
CTGGGCAGATATCGTCGCATCGTTC