Description :
From Genome Similarity Track
Location :
contig_47:19613- 21036
Transcript NameFunction/comments
g9608.t1hypothetical protein

Sequence
1423 bases(100 bases per row)
CTGCATGGCGTTGAGTCAAGCGGGAGATGTCTTCACCTGGGGTGAGGCGTCTGAAGGTCAACTTGGCCACGGCGAGATGCATGAATTCTACCAAGTTGCA
CTCGCTGATCGGCACATGGTCAGCTCGGCGTACACGTACTTGGCACAGCCCGAGCCGGTGCTGGCACTGTGCGACGTTCGAGTGACGCAAATTGCATGTC
GAGGAAACCACTCCGTCGCTCTGAGTGCCGATCACGCGAACGCTAGGCTTTTTGAGTGGGGTAACTGGGGCAGACGGCGTGGTGTGGACAGCGAGCACGC
CTTCGTGCCTGAAGAAATGGCCGGAGCTTCCGCTCTGCGTCTCCGTCAGGTTGCAGTCGGAGATCACCACATATTAGCGGAAGGAGCAAGTGTATGGCTT
AAGCTGGTAACGCGCACGAATGGACCGGTCCAAGCTGCTGAGCACGGAGAGGAAGAGACGGGATTCTTTGTGGAGCCACTGGCTGGTGCATCGAGCTCAC
TTGATGCTATCGAGCACGATTTCATGGGAGAAATCTCAACTTCGTGGGTCTGCTACCTTGTTGACCTGGACGCCGATGACGTTGACGAAGTCGAGAGTGC
GAATAACGCTACCGATGAGCCATCGTCTCGACCTAGCACAGGCAAAGTCGATGGAGCACTTTGGCAACGGCGAGCGGAGCGATTCGCTGTTAGCCTTGAC
CGACTGGCAGAATTCGACCCTCGTTCACTGCGTCTGCTGGTCAGTGCACCCGGAAGTGCAACCGATGCTATCAACACCTACGCACAGGGAGTGGATCAGT
GCTTACGTGGTCGCGTGGCAAACCGTCTTGTAGTCATGCCTCGAGGTAAATCCGCCGGGTTCTACGTGCAGTTCCGCCTTCCTTTAGCTACGTCTAACAG
TGCAGCGCTTGGACCGGAGACAAACAATGGGGACGCTCGAGCCGAGGAACCTGGTGATGATGATGATCCTAATAGCAGTGCTGCAGCTTCCGGTGTAGTG
CTCGAGCTTGCAGTTTGTGGGTCTAACACCGCGAAGCAAGCAATCAGCCGACGCGGATTTGTTACACACGTATTTCATCCGGCCATGGAGGCCGCGGCCA
AGCGGCTTAAGCAGCAACAACTTCGTGCACGTTCAGTAACGAAGAAAAGCCCACGGTCGCACCCACGGAGATGAACAGCATTTTTGTGTTAGAGATTGAT
CAGAGTGTGCTTGCACCACTAGCTTCAGCCGTGACTGAGAACGATCCAAGCGCTTCACAAGAGCCCAGTGCTCTTGGAACTGAAAGCGAGGCGGAGCTTG
AAGCGGAGACGATTATAAGCGAGATTGGACATCGTGTACTGGAGCTCCAAGAAGCAGGTGCTCTTGTTGTACTTGTTGTGCTTGATCTGTTTGAAGCAGA
AGCATTCGCGCTGCAGTTTTCGG