Description :
From Genome Similarity Track
Location :
Scaffold_135:19610- 27971
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap-piw_contig_135-abinit-gene-0.41Myosin heavy chain
Pytiw_DAOMBR242034maker-piw_contig_135-fgenesh-gene-0.7Pattern formation protein

Sequence
8361 bases(100 bases per row)
CGAGATCACGCGTCTGAGGAATGAAGTCCACGCGAAGGAAGAGACGCTCAACCAGCTCAAGCTCAAGACGAAGGCGTTCGTCGACAACATGCGCGGCGAG
CTCGCCACAGAGAAGAAGAAAGTGACCGATCTTGAAGACCAGCTCAAGCACGCCAAGGGATCCGCAGCCGCTGCTAATAGCGCACCGGTGCCTCAATCTG
CGAGCCCAAGCGAATTGGAAGCGATGAAAAAAGAGGTGGCGATGGTGACACAGCGGGAGAACGAGCTCAAAGCGAAGGCCAAATCGTTTGCAGATAGCAT
GAAGGCGCAGCTCCAGACCGAGAAAGACAAGACCATCAAACTCGAGCAAGAGCTGAGCGCCAAGATTGCGGCCTTGGCGCTTGCGCAAGCGAGCGTGGCG
ACGTCGAGCGCATCCGATGACCTGCTGTCGCTCGATGACCCAGATCCATCCAAGAAAGACGACGAGATCGCAGCTTTACAGTCGAAGCTTCAAGCCGCGC
AGCAGGAGCTTGCAGAGACGAGCGACCGCATGCGTACAGCTCAAGATCTTGCAGCTCAGCGAGAACAGGACGCGGCAAAGGCCAGGAGCACACTTGAATC
GCTTCAGTTCACGAGCGAACAGCAACTCAGTCGTATGCAAGCAGAGGTTTCGGCACTCAAGATCAAGCAGCAAGACCTCGAGAGCTCACTGGCCAGTCAG
AAGAGCGTTCAAGGAAACGCCGACACTGCAGTTGTTGAGGAGCACGGCCGCTTGCAAGAAGCGCTGTCGACGAATCACGAGATGATCCTCCAGATGCAGC
AGTATAAGATTGAGAACGAACAACTGCAGAAGCAGTTGCTTGACAAGGACTTCCAGTTGGAACAGTGTGGAAGCGACCGAGAGCGAGCCGACGAAGGTGA
AGTGAAGGCGAAGCAGCTCGCAACTGATCTTTCGGCGCTCCAGGCTCAGCTGCAGACGAAAACTGAAGAAGCCGCGAAATCGTGTACGCGCTGTGGCGAG
CTCAAGGTCGAGCTGTCGGAAATCTCTGCGCTCTACGAGAGAGTGAACATCGGGAGAAGCCAGAGCGACATCCAGCTCGCAGAAGCACAGACTGCGCTCA
ACTCTCTCCAGAGCGTCCAGCAAAGCTACGCTGCAGCAAAGGAGCGACTGGATGATCTTGCGACGCAAAATATGGATCTCAACGAGAAGATCTTCCGGAA
GGAGTCAGAGGTCAACACTTTCAAGGTGGATGTCGAGAAGCTGACTGCGGAGGTTGCCGCTCTACAAGGACAAGTCAGCGCGTCACGATCGGATAGCTCG
TCTCGAAAGCAGCAGTCGGAGACAGCCCAGGCAGAGAAACAAGCAATCGAAGCAACGCTCAATGATCTGCAGGGAAGATTCGTCCAGCTAGAGAAGAAGA
ACCAAGAGCTTACGAGCTCCATTGAAACAATCAACAAGGAGAACAACGACAAGCGTCAGAAAGCCAAGGCGCTCGTGATCTCGCTTACAAATGAGAAACA
GACGCTCGTCGACGCGAGAAGCGAACTGCAGAAGGAGGTCGACCGACTTCGCATGGAGCTCAACCAGCGCAACGTCGAGAATGAACGGCGCCTGAAGCAG
CTCAACGAAGAGAACAGCCAGAAAGTCGCGCAGAGCTCATCGAATCTCCAGAACCTCTCTGATGAGATCGCAACTTTGAAGCAAACCCTCATGATTGTCC
AGGAATCCGAGAAGAACCAACAGCGAGCGAAGGAACTCGCGAACGCGAAGCGAGAGGTCGAGGACTCGAACAAGAAGCGTCTCGCTGCGAAGGCTGAGAC
CCAGAAGCTTGCCGTTGAACTGGAAAGCGTGCAGAAGTGTCTGAGCCACATGGGTGACCACGCCAACACGAACTGCTCTACCAGCGTCCGGAAGATGTCG
CAGCTCCAGGAACGAGTCAACGAGGCCCTTCAGGTCCTCGAGAAGCGCGCGCAAGCGTCCGCTGCTGGCAAAAGGTCACAGTCAGCATCCGGAAATCAAG
ATGATCTCGAGGTGGAAGACTTGCGCGAGCCTGAAGTTGCCTCTGGTCGCGAAAAGCCCACTTCGCCGACGCAAGGCGCGAAGAAAGTCGAGGAGAACAT
CGCGCGAGTGAATGAACGGGTACGTGCCCAGGAGATTCTTGCGTTGCTTGTGTATTAGCTGCTCACTTTTGCCTCGTTTGTTGTCAGCTGTCGCTTGTGA
TTGAAGCGACCGAGAAGCTCTGCGATATGGCTCTCGAGCAGAACGAAGTCAACCTGAAGGACGTGGTGATCGACAAAGTGACGCACCTGTTCACGCAGTG
CTTCTCCGAGAAGCTCCGAACGGCGTACTCGAAGGTGGAGGAGGCAGAGGCTTTTCTTGACTCGAATCACAGCAACAACAACAACGGACAGAAGGCGTAA
GCGACATCCAGATCTTGAACCTGGCTGTCTGCGCAACAGGACCTCGAGACAACGTGAGATGTAAATTTCATTTTATATACATTTCTTTATCCACATAAAT
CGGCACCTTCCTCCGGAACATGACAGGTCTACGCCGCTTCGTTCGCAGTGCTGCCTTCGTTGTCCTCTTCCAGTTCGCTGCCATCAGCAAGCGGAGGCGT
CATCTCTCCAGACGAGCTCGCGTCTTCTCTCGTTGGAAAGAGCTGCTCAAACAATCCAGGATACGGCTGGCATTTCTCCACCAGAGTGTGGACCAGCGCG
TGGCACTTGCGAGATTCTGGCGCCACCGCAGACGAGCTGCCCTCGTTGCCCAGTTGCAAACCCGAGAGGCGTCTCGTGATGCCCTTGACGTGCTCCAGGA
TCTCTTCGTGAGTCGATAGCACGCTGCGTCTCTCCAGTGCAGCAAGCGCCACTTCGCTGCTCCCACTGCCACCGTTGCTCTCCATTTGCGTGTGGCGCAA
CAGACTGATGAGCAGGTCGACGAGTTCTTCCCACACGTTCGAGAAGCTCTCAAGCTGACTCAGCTGGCTCAGCTCTTCGCATACCACACCAGAGATGAGC
TGGACCATAAGCACGTGTGGGCGCAGCGCGAGTGGGTCTTTTACGACCGAAGTGCGACGACGACGTCCTCTCCCAGTCTTCGTCAGTCTTGGGCTCTGCA
AACTCGATGGTGGTTGAGACGTGGAGCGAACTGGCAGCTGCTGCTGGTAGTACAAGATGTGCGGCCACGCGGCACTCGAGTCGCCCTCCACAACCAAGTC
CACACTGGACTTCTCAAGCAAAATGTCCACACCGAGAGGAAGGATGCCGTGCTGTAGAATCTCAAGCCATGATGCCGTACTGAAGAGGCTTTTGCTGCGG
CTGCTTGAGCCCAGTAGCATCTCCTGGATGAAGCCCAGACACGTCACGATCAGTTCGCTTGGGGGCACTGACGAACCCTGGTCAGCTGGCAACGCGTGGT
TCTTGAACAATTGTCGACAAGCAAGGATCGAGCCGCCTAGAAAGCGCAACGCGAGCTCATGCGTGCCTTCAGCAGCGTCTTCCGAGTCCAAACTGTTGAA
CATTAACTGCAGCAGCTCCATCGGGCGCTTTGGTTCCCAGCTCTTCTTGTCCTTCTTCTCGCCACTACCGTCCTCTGCATGAGTCAAGGCGAACATCATG
ACCTTCGTGAAACAGTCGCATATCGAGAGTTCGCTCCCATCGACGCGCCAGAGCTGAGCTTCCACGACGTATTCCAGCACCGCGAAGCCATGCGCTGCTG
CGAAAGTCGAGTTCACGGACCAGCTGATCAGGTTCGTCACCACGAGCCACTGCTCCTGGGAGTATTGGAGGGAACTTGGAGCCGTCGACGCAAAGAACTT
GGTGAGTCCCGACAGGATCTGGCTCAGGAACGGCCGCACGAGCTCGTCGTCACCACTGCTCTCAACGATCAGCTCGAGCACTGTTATCAATAGAGCCCTG
GCTCGCTCGCTCTGGAGCTTGATCGCAAGCGCGAAGACGCCGTCGATTGCTTTCTGGAGAATGAAACACGCGGTCTCGTACGATATCCTTCGAGACTCCG
GTTCCTTCTCCACACTCGACAAGATAGGGAGCAGCGTCTGCAAATGGCGAAAGTAGTGAGCTTCGATGACCTTGAACACATCTTCGTCGTCATCCGTCGC
TTCGCCACCGTCGCAGACCAGAGCATCGCTCTGTGAGATGATTTGGCTGAGGAAATGCTCGAAGAGCACGCAACCCGCAGAGCTCAAGTCCTGCGATACC
ACAGTCTTCTGCGAGCCACCGTCGTCGGATTGATGGTGCACTGGTTTCTGCTTTCTGCCGTCAGCTGGCTGAGACGGGCCTCCAGTCAGTGTACGCGTCA
ATTCATCGTCCAGAGCTTTGACGACCTCGGCCAAGGCGCGAGAGGGCAGTTTGGACAAATCCTCCACCAGGAACTCAAGTCTGTACGGCTGCAGCATCGA
CCGAATCCACTTTTCAGAGCCAAACTCAACTTCGTCGCCCGATTTCTCCTCATTCACATCGACTCGTGAGGTTTCAATGACGAGGTCGTGCGCGTACTCA
GCCCACTCTGCAGGATTCGACGGCGAAGCATCCTCAAGCATGTTCTTGTTCAGATGCGAGGTCGAACTCGAGAACGAGGAGTCCGGATTCGATTCGAATG
CTGACATGAGCCACGCGACGCCACTGAAGAACCCACCGCTGCTCTCAGGTGCTGTCGTGAGATCCTGCTTCTTGAGATCTTCGCGTCGCTGGATCTCGTC
CTTGTTCTGGTACACGAGCTCGACAAAGTTGATTCGCTCGCTCTTTGTCGTGAGATTTGACTCGCCAGTAGCACTTGTTTGCTGCTGGTACAAGAGCCGC
GAGGGGAGCGCTTGGAACTCGCGCAGCGCACTGATCGCGTGGAAGAAGAGCGCCCAGGACTCACTACTGAGCCACAGACTGCACGTGTTGACCAGTTTCA
GCATCCCTGCGGTCGCCACCGACGCGCTCTGGTTGCTGCAGAAAAGCCACACGCCCTCTTCGCGCCGGTTGTAGCCCATGGGGTACGCCTCAGATTCAAA
GAGCGCAGTGTACTTGCAGATGCGACCGAAGACCGCATTGAAATGCTCGGGGAGCGCCAAGTGCGATGATGCGCCAGCACACAACACGAGCCCATTGCCA
GCCAGCTGAAGCATGCTCTTCTCTGGGACGTAGTACGCCGACTGACTCGAGTGTTCGTCCGATCGCGAAGGTGCATCGCCATCGCTACTGCCTACTCCGT
CCTTGTCATTGGATGCGTCCACAAACTGCTGAAAGACGCTGGTGAACGCGCGCACCAGTTGCAGCTGGATCAGCTCGAAGATCTGCCGGTCGTACTGGTC
ACCAACGTAGTAATTGTGTTGTGAAAAGGCCTCTCCACCACCCTCAAGCTGGTCTTTCACGTCCACTGCCAAGCCGTCCTCTCCCTTATCGCTGAAAGAC
TTTGAACGAGATCGCGACCTTGAACGAGCTGAGGCGCCCCGTGAGAGAGCTCTTGACTGTGTCGAACGAGGCTTGACATGGCGAGACTGACGCTGAGAGT
GCTGCTGATTCTGAGCGTGTGCTCGAATCGAGTCGACTGTGATCGCTGTGAATGGCGTCGGAATACTAGACTCGTGCGCTCGATGGTGCACAATGAGCCT
CGAGTTCCGCGGATCGTTCTCCGCCTGGTTCAGCAGATCCTTCCAGCGGTCGTTCGTCACTTCACCGTGTTTCCCACCATCTTCAAAGGTCTTGATCTCG
TCATTTGCGATCGTGTCGTAAATCTCCGTGAGGAAATCGTCAGGTAGATCGCGATCTCGAGACACTTCTTTACCGTAGTTCTTGTTATTCTTGATGAAAT
CCTCGAGCTTCATCTTCTTTTCGGGTCGGATATTCGCGTTGTGCAGGTCCGTGTTGAGCATGATGAGGCTGAACGAGAGCAAGTACGCGACATCGGGCGA
CGCCATGAGGAACCGGTCGCGACATTGCTCGTACACCTGCAGTGAAAACGTGTTAAGAATCCGATCGATCTGCTGGGCCTCGCCTGGGAGTCGGAAGCTC
GCGAGGAACATGCGCAGCGCCGTGACAATGTTCTCGCCTTCGAAATTGAACGATTTCACAAAGTCCACGAGCACCTCGCGGTGGAATTCTATCGTGTCGG
CCTCGTGGATCTCGGCTTTCTCAAACTCCTTCACGTCTTTACCCATTGCGCCCAGGTACGCGCCCACGGCGTTCTTATTCAGCCCCTGCGGGAGCGAGCG
CATGAAACCCGCGAGCGACTTGGTGTCCAGCGGCGTGGGCAGGAACGTGTTTTGCTGAAGGTACTTGATGCCCGCGATGGGCTTGCGATTGAACTCCTGG
ATGCCGTGCTGGAAGAACTTCTTGCGCTGGCGGCGCTTGTACAGTGCGTTTGCTGTCGCGTATCCAGCGCTATCGCGAGGGGATGTAACACCAGTGCTGG
TCTCTTCGAGCAGGCCGTCGTCGTCTTCACTGGGGATGCTCGTACCATTTGCTGTTGCCAGCGCAGCCATGGTGGAGCTCAATTTTGGCTGCCTGTGCTG
ACTGCGCAGATACACCACGTAGAGAGCGTTGAAGAGTCCGCGGAGCGCTAGCTCACCGATCCCCTGCGCCCACAAGAAATGCGCTTCGTCGTGGGTCTCG
CGACACGCCGCGTGCGAGTGCTGCGCCACCTGGGAGAGCAAATCAAAGATGCTCTGCGTCAGGTCCGAACGGTTCCCGTCGCAGTCGTAATTCACATACA
GGTCTGGCAGCAACGTTGGCTCGGCAAGCAGGTCCACGAGACAGTCGAGGATCTCAAACGACGCCGCAAAGAGCCGCACGGACGACAACATCTCGCCCGT
GAACTCCTCGGTGGCTGGATCGACGCGACGCGTGGATTTGGCCTCGCGCCCGGCACTACCGTTCGCTAGTGAGGTGCTGGTCTTGTTACCATTGTTGCCG
TTGTTGCGGTCCCTAGGGAAGTTCGGGTTCGACGTATCGAGACTCGCGATTGTCCAGTGGAGCGAGTTACAGAACACGCCATTGAAGATCGCCTCGAGTT
GCATCTTGAGCACTGAACGGAGCTTCGTCCAGAGCAGACGGATAATGTCGAGGCAGCGGATTAAAATCTTCATATCGGAGCAGGCCCTGCAATCATAGAA
CGACAAAGTCCACAACCAGATTATGATTTGTTACGATAAGGAGGACTCATAACATAGATAATTAGTAACACGTACCCCAGGCGACAGAAGCGCAGCAGTC
CGCTGCAGAGGTCGTCCTTGACGAAGAGCATGAGTGACGGCACCTTCGTGATCAGGCGCGCGTCGCACGACACCAGCAGTCGGTGCAGCAGGTCGAGCGC
CAGTAGCACTTCGCGGCGACTGGACGCGAACGAAGCCGTCACCCCCGAGCTGCGCTGGTGGAGCTTCTGACAGAGGAAGCCCAGCGTCTTGACGGCGCAC
GGCAGTCCAAAGCCCACGGACGGTATCATGGCAGCAGAAGATGACGATGAGGCCGCGTCAGCATACACGGAGGGCGACGTGAAGATGAACGTGATCGCGT
CGTGCAGGTGGTTAGTCGCTGTGGCCCGTAGCGACAGAGTGATGTCTCGCTGTATATACGGTATACACCAAATTACACAAGTATAGTTAGCTAGTCTGCT
ATACACAAGGTACTTCAGCAATGCAAAAGGGTATGATAACGTACGTCACTGCGCGACGCTCGGCTGAGTGCGTAGAGCGACTCGACGAGCTGCCACATGG
AGTGGTCGGAGAGAAAGGGGGCCGCGTGGGACGCGAGCACGGCGTGGAGCACGTCCACGACCAGCACGACCACGTGCGCGTCGCTCTCGGCGTTCGTCTC
CTGGAAGCGGCACTGGCTCACGGCGTCGACGACGTCCGAGACTGCGTCCGCGACCGCATTCGAGTCTGCCACCTGCGACCAGGGCCACGTCGTGAGAAAG
TTGCGCACGACCTCGAGTGCTGCGCCTGTGAGCGTGCTGCTGGTCGTTTCGTGGCGAATGAGATCGAGGAACGGCCGGAGCACGATCGCTGGATTAAGCT
CTGCGAGGTCTGTTTGTTCGCACGAATGCACAGAGATACGGGGTTAAGCATATACACGACCAGCATATTAAAAAATAAAGAGATACATGGGACGCACTCT
CGCAGCGCTGCACGCGCGCTCGAAGCAGCGCGAAGCTCTGGAAGATCGCTATCTCGGCGCCATCCTGATAGAAAAAAACACATACTTAGCCATCCGTACA
GACGCGAGCAGAGCGACAGCAGAGACACAGAGTGGACCAGGAGACGCACCTGCGTCTGGCGCTTGCGGTCGGTTGCGAGTAGGTACCCGAAGCGACGCCT
CGCGACGCTCAGCACGCGCTGGAGGTCGCCCAGCAGCACCGCGCGCGCGGCCATCGTCTCG