Description :
From Genome Similarity Track
Location :
Scaffold_514:1960- 4270
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_514-fgenesh-gene-0.0Transmembrane protein

Sequence
2310 bases(100 bases per row)
TGCACGTGCTCTTCCTCTTTGTCGGCTACCTCCCACCGATGATCTTTGGCGCCGTGACCAGCGCGATGGCATTCGACTGGCAGTGGAGCCACCCAAGCAA
CGAGTTGCTCGTGTACGTGCTGAAACTCGGCAGCGGTCTTGTCCAGGGCTTGATCGTGAGCCCGTCCAAATCTTCCTTCAACCACAATGCGCTCTCACAC
GTCATTCTCAGCCTGGCAGCGACGTTCATGCTCGTGCACTTCAAGTTGTAAGCGCGTGATGTGGCAGCTCAAGAAAATGAAAGCAGTAATGAGCAGGAAG
GAAGGAAGGCAGGCACGTATAGTATCTCGAAACAAGTAGGACAATTAGCGGGGGTCGTGGATGTGTTCCCTCTTCAGGCTTGGTCGCACGCGCGCACGCA
GCAGCAAACGTCAAGGAACAAGGAGCAGGAAGATGAAGATGAAGATGCAGCGAAAACAACGGAAACAATGAAACAATGATTATCAAACCAAGAAGGTATC
TGGTATTGCATTGTCCATGTCAATCCGAATTGCTGTTGATCTGTCTGAGAAATGTGATAATGGGTATCAGCACAATATCCGAGAAGCTAACAACAACATT
GTTTGTGCCTTCAGGAGTTTCGCTTTCGGAGTATGAGCGCGTCAACTTGTGTGGTGGCTATTTATGAATGTAAAGATGGAGAAAGAGCGCAAATACCGGT
TTTGAATTTGGCTGCTGCTTGTTCGCCAGCTTGCTTCCAGGGACAAATAAAGCAGTAGATGCGAGCCGTTTAGGCTCAACAACTGCTGGTAAGCGTTGAG
TTCCCATGCTGCTCTTTGGCGGGAACTTGTCTGGCGCAGCAAAGAAGTTGGACCCAGTACAACAGCAACAACAGAAGCACAGCACTGATGGACTCAATAA
GAGCGAGCGCGTCAAAGATGAACATGGCGGAGAGAAAGCCGCATCACCACGTACGGATGTGCTGCATCGCCTCACAAACCACGAGCTGCGGCTGCTCGAG
GAGCTCGAGAGAACGCGATCACAGCTGCAGGCAGAATGGCGTCACAAGATCGCTGATCTTCAGCTTCAACAGCAGCACGGGGATTATGATGCTCCAAGTG
TCGAGCAATTGGCGCAGCAACTCTCTCTGCCGAGTCCATCGTCGAAACCGGAGGACTTGAAGGCGATGATGCGCTCCAAGACGCTCGTTCGCAAGCCTAA
TCAAAGCGCCAAATCGATCCTCAAGCACAAGAAATCGCGATCAAATGGAGCATCCAGCGGAGGAGCGACAACAACCAATTTCAACCCTGCGAGCAACAAT
TTGCCCCTGTTGCGCTCCAATATGGATATCCTGCCTGTTCTCACAACCTCAGGCGAGACACCATTTGAAGTGGGACTCGACGGAAGCTCCAGTCCAATCC
CGCAGCAGCACATACTGCCGATATTCCGACTTCCCACAGTGAACGCCACTGCGACTGCGACTGCGACTGCTATTAAAGAAATCGAGGTTTTAGAGGAAGA
CAGAGACCGGAAGCAAGCGAGTGAAGCGCTCAGTCTCTCGTTGGAGGAGATAGCAGTTCTTGAGGCAGAACTGAATGGCGACAGTAACATAAACATCAAC
CAACAACGGCAGATATTGTCACCAGAACTGAACAAGAAACTTCCGGGGCTACATCACCAGCAGCCTAAATCAAAGAAACCCGGTCAACGGGGGGAGTCGA
AATGGAAGCAAGGGAAACGTGCAGGCGAAGAAACGTCCAACGAAGATCTCCAAGCACAGCGAAGCGATAACCTCCGAAAAGAGCTCGAGTCGGCGCTATC
CAATGTCCAGCACCTCACTCGTTTAGTGAAGGACGACATCGTCTTTGCACAGAAGATTTGCCCAGCGAACGAGCTGAGGACCTCGGTATGTGCATGGTTC
TACAACGCTGTAGCTAACAGTCTGACCTGACACATGTTTCTACGTATGCCGAGCAGCTATACTTCAAGCGATGGGGACGTGACAAGGTCGAGAACATTTT
CCGCCGTTTGCTTTTCAACCTGCAGGGGATAGCTTTTCGAAAGTGGAACCAAGTGATCGCGCACGAGAAACAAGAAGAGAAACTGCAGGCGTACCTCATG
TACAAAGGCTCAAAGAAACTCGATCACTTTTTGCTCAACTGGTCGCAGCGCAAACTCCGCCAAGCATGGACGAAATGGTGGTCAGACATCGCGCAAGTGA
AGGCTATCGAGCGGCTAGCGCTGGAATTGGACGCCATTCGTGTACTCCAGCGAGCATGGAGAGGGTATCGCGGTCGAATGTTTGCATCACTTGTTAAAGC
ACAAAAACTC