Description :
From Genome Similarity Track
Location :
Scaffold_515:196- 3652
Sequence
3456 bases(100 bases per row)
TAGCCAGTCATCGAGTTCTACTGCAATCACGCCGTCGGCCCAGCTGTCGCGATACCAATGGCGGACTCGGGCACTCACTTTTGGGGTGCAGAGTATACAC
TCCTGTTGCCTCTGTCTCCGTGGTCGTCCACTAACTCAGTAGATATTCTGGTGCCGTTCACTGCCACGTTCGGCTCCATCGTTGCTGTACTGCTCGTATC
TGCACCTCGGTGTGAAGGCTCGCCTCTTGCACCACGATGATATCAGGTTCCATTCGCCCCCGATGCCGTTTTCAACCATTGAACCAGTGGCTTGTTGCTT
CTTGGCGAATCCCATTAAATGTTGAGTTGAAATTGAGATGGTCTGCCTTGTTCGTCGCCCTGGTAGTCGACGTGATTGGACAGATGCAATCAATGTAGAA
ATATTGTACAATCACTGAAGTAGTCTCGCTCGGGGAGCCTTGTTGCCGTTTCTCTGTTATCAATCACGGTTATTGCGAATGGGATGGTGAAGCACCAACT
GCGTCATTTTGCCGGGTTATTCCAAGTACAGGATCAGTGTTGTTTCGATGATGGCCCAAACTTCGAAAGTCTCTGCATGATACAACGCTGCGAGGATCAC
TGGTACTTGCTTGGGCACTTCGAACAGCAACTCAAGGTGCTCTACCACCGTTGTGATGGCTCGGTGTGCTCCCGTTACGACGCCTCTTAGTTCTGCTTCA
TAGATGAATGCAGCCAGAATCATCCGCGAGAGCACTTGCGTTTGCGAAATTCGGCAGAGCTTAAacagcttggccttgccaAATTGCGCTGCTTTCAAAG
GCTCCATAGCACTGGTGGGTGGAGGCGAGTCGTATAGAATAACTAGTGGCTGCTGCACGTATATCAGCACTACTTTGCCGGAGCCATTTTGCGCGCTATA
CCTCTGGGTCCACGCCTGTTGCCCACTCTTCCAGTCCGTGCACTAAGCAGTCGAGCCGACTCTGCTGAGCCCATACATCAAACATAGAATCCGGCAGCAT
GCTGAGAATGTATTCCTGTAACTGGTACGACCTGAGGAACCGAAGTAGGTTTCTTGCTGCCCCCGCCACCGCTTTTCTCAGCGGGAAGTGCCAGCTGGAA
CGTTAGGAAACGGCGTGGTTGTCGCCGCTGTCCATTGATGCTTTATACTATTCCATTCAAGCTGCAGGCTCTCTTCCGGAGGCGGTTGCCTCCCAAGTGT
GTCTCTATTTCATGAAAGCGGCCTATGCCGGTGCGAGGGGTGCCACTTTCTTGTCAACTCTGGTTATCGATTTCCTGTGAGGCCGTTGGCGTTTTATCTG
CCCAATTGGATCCGCTCCTCAGGTCAGGCAATGTTGGGAAGGCGTTAGATCCGTACTCACCTCGAATTTATGCAGCCGAATGTAGAAACAATGTGGTAAA
ATCAGGGTGGTGGTCATTACTGACTGTAGTCCAGCACCAGTTCCCCAGAAAAAAGTGCCCTTCTCCTCCGGGTGTGGAGCGGTAAGTGGTGTGCCCTGTG
ACATGGCGGCGGGCGCTTGCGGTTGTCGTTTTGAAATTGACGAGTTGTTCAATCCACCGGTGGTGCGTCTCCATCGCAGCCAGGTGTTGGCGGTGTTTCC
TTTGATCGCTTCCGATATTAAGATGCCCTCACTTGCTTTATCcggcttctgcagcactgaTGTTGTTTACATGCGATCGTTTGCCGGTGCATCCtccgcc
ccccccccccccccccatgcTCGAATTTGGACAGGAGCTGTTTGGCATCGAGAGGCGAGACGGCGGTGCATCATTCACCATCCGTCTTATCATACGAAGC
GGTGACAAACGAGATTGCATGATACAAAAGAAATGCTAATACGAACCAAACGGTATGTATTAGTACAAACCAGTGCGGGAAATTAAAACTATTACCGTTC
GAGATTCAAAACTGTCTCCAACGTCAAGAGAAATTTAGAGCTCCCAAGTTCAAGTAGGGAGTCACATTCAACCAACATTCACTACTCTGTTACTCAATGT
TGGGCATTGTTGTGGTGTTACCCAAACGTAGGAACATACTTCGCAAGGGCAAGCGACCTCGTGAAATTTTCTCGATCAATGTTGTATCGAACGGTTCACT
ACAATGACTCCCGCTCTGTCCCACATTGCATGCCTTGTactggtattaatacctgaTGTATACCCCACTGCGTCTCAGGTCGGTCATTGAGATGCCTCGA
ACGTGACACTCGAAAACAATTAGACAATTGAGTTACTGCCAACCTCTGCCGACAATAGACACCGCAGTTTCAGACGTCATATTGGCTTCGTATGGCGATG
CATGAATGCTATTGGATCTACAAGTGGGAGAGGaggtgtgtgtgtgcagGACATGCACGTGCAGCTAGTGCGAGGAGAGGCAGCAGAAGGGGACATGAGT
AACCCGAATGAAACGCGTGGCCACCGTGCCCTGTGATTTGTTTTGAAATAGTTGGTCTGGATAATTCATTCCGATTTTGAAAATTACCGGCGTAAAAATA
AATTTGACCATCACTTCTGTATGCACCACCATCACTTCCATATGCCCCCATCTGCGTTGTTATCGCTACCCAAGCTGCGTGGGTATTTGTACTCGCATGC
TCGAAGTGGCTGTCAATGGAATGGGACTTCACGGCATTCGAACAATTTCAGAAATGATCCGGAACATTCAGAAGTTGTTGCCAAGTGGCACTAGTCCCGA
GTGCACCATGGCCATACCAGAAATAAGGTCTGACAGCATAAAACGACTGGATGAGATGGCAGCAAACTTCACGGTTACTCTCTGGTCACCCCAATCCACC
TCTTGGAAACCGGCCTTATGCTACACGATCTCCTCGGCCGAAAACAGGGATTCGCGAACCAGGACGTGAGTATAGTACATCACGGCTCCGTTGTTGCCGG
AGTTGCCACAGCTAAAGCGACTGTGAATACGAGTAGTTCACGGAGATGCCGAAGTGACCTTGTTAGCGACCATCTGCAGGGATTACGGATTGGAACAAAT
TGACTGGATGGCCGCGTACGAGCCGTGCGCGATGATATTACCACACCAGTTGCTGGCGAGGGTATTGATcacgagttgaagtgatcaagttgaaggaTTG
AATTGTGTTACGGGAATGCTGTACGAATGTCGCTTTAAAATGAAGTCGCTcgaatgtcgttcttgtccgactgggtcaacacTCCCCCATTTTACATCGA
ATGTGACAGTGAAAGAATAATGTTTACGGCATTTTAATATTGTAACTCATGCAGAGCCAAGTTTCTCGAAATTACAAACGTATCCAAATATACGTTTATA
GATGATAAACGACAAAGTGCCCAAACTCTGGATAATAAACTTCCAGAGAACATGCAATAGAACAAATGCTCTCGCTGATTTAGTAAACAGTTATTTCTTT
ACCGGACCGGAAAAATATACCATAAACCACGGCCTCAATGTAAACAGGTGTAAACA