Description :
From Genome Similarity Track
Location :
Scaffold_1026:196- 2575
Sequence
2379 bases(100 bases per row)
GAAGTGCGTTGGTGCGGCAAGATAATTAGCGGGAATGGCGCTCATCCCTGAAAGGATCCGAGCGCTGCAAGCATTGCCGTATCCGACGACTGCTGGTGAA
CTTAAGCCATTTTTGTGTGCTACAAACTGGATGCGTGATTCATTGATTGACTATGCTCGGATGGCAAGACCGCTTCAAAGCCGGTTTGACAATGCACTGT
CGCGAGCTTCTCGGTGGACTAAGCGAGTAGCCGCGGGGATTGCAGTCTCCAAAATCGGTGAAGTTAATATTAACTTTGGGTGGAGTGGAACAGGAAGCAT
ATTATGAAATGAAGCAAATCCTATCGACCAGTGTGTCTCTGGTCTTGCCAAAGAACGGGTCGACGATGTGTTTGTTGACGGACGCTAGTGATTCTGGCTG
GAGTGTAATTGTTTCTCAGGTACACCAGTGGATACGTCATAAAGCAGTACATGAGCAGCAACGCGAGCTCCTGACCTGCATGAGCGGCACATTTACGAGA
TCGCAGTGCAATTGGAGCATCATAGAGAAAGACGCATTTCCTATATTGTGCGCCTGCGATAAATTTAGCTATTTACTTCTGCGGCTGGGTGGCTTTAAGC
TGTACTGCGATCACCGCAACCTCTTATACGTTTTCGCGCCTAGTATATAGGTCAAGAAACATATTAGGGGGGAAATTGCTCAGATGGTCGACCAAGCTGA
TGGATTATCGATACGAAGTCGAACATTTAGAAGGAAGTGCCAATGTCTGGGCCGACACGGTGTCCAGGTGGACCGGTAATCACGAGCCTTCCGTCCGACT
TAACATGATGAAACTCAGGAAACGGGCTCGCCAATAGCCCGATGACACGGTGCAGCGACCCAAACGCCGGCGACGCAGGAAGAACAAGCCTGCGGCACTA
ATCGCACATGACGAGCAGCCTTAGCGTATTTTGGTACATCAACTACGACCACTTGATGACTCAGAATTGGAATGACCAACCTTTGACGCTATCCGTGCCG
TACAACAGCAGCACGCATCCGAGTGCCGCCGGCAAACAACTGGCGATGACGACACTGGATGGTTCATCGAGAACCAACCTGTGGATTCCTAGAACAGCGT
TTTCACTAACTCCGAGACTTCTCATAATTTCTCACTGTGGATATCAAGCCCACCGAGAACTCGAAGCAATGATTACCAGTGTTAGTCGTAGCTTCAATGT
GCACCACCTTCGGTCTCGTGTTGATCATTTTCTCTCGACCTGCTTGATGTGCAAGCACGTGGAAGGAGCCAACGTTGTACAGCGCCCATGGGAGCCTACT
AATCGGACAAACGAGCGAAATGGCGCTCGATTTCTTGTCACTTGGTGACACATTTGCTGGAGACAGCTACTTGCTGGTGATGAAAGATGAGGCCACGCAT
TTCACGGAGCTGACTCCATATGCTACCCCTACAAGCACAGTTGTGGTGGACGCGATGCTCGCGTGGCACAGCAGGTTTGGGTTGCCCCACCTCTGGAGAA
GCGACCAAGGATCCCATTTCCGAAAAGAGTAGACGCATGAAAGCACGGCATGACTTTACTGTTGCGTACTCGCCGTGGATAAACGGTAGTGTTGAGCGAG
CGAACCGTGATATCATTCGAGTATTGCGAACTCTCTGCCTCGAGTACAAGGTGTCCACGCACGATTGGGCGCTTTGTGACAATGCTGCAGGCCAACTTGA
GCCACACAGCGGTGCCTTCACTGGGAAACCGAGCTCCGGTGGAGCTTTTCTGTGGTTTACCAGTACCACCACCTCTCCACCTTTGCATGGATCCTAAACA
ACGAAAAATCATGGAGATTCCTCAGCAGCCAGAGGTGATATCGAGCTGGCTAGAGGAACTGCGCAGCAGTATTCGTGACCTGCACACACCAATGATTGAA
GAGCAGGCACGACAGACCGTGCGCAACCAAAGACAGCAGAAATTAGCCCGACGTCCGAACTTCGACATCGGCGACTATGTGCTACTGTCACGGGTAGACC
AAAAGCACTACGATAAGCTGTTGGTCACTTGGGTCGGGCCATACCAAGTCGTACGTGCCGACCCGCATTCTTTTGCTGCTCGACACTTATTAACGGGTGA
TATATCCGATGTGTACCCTTCTCGGTTTAATTATAATGCCAACAGTACATGTAAGTACCTATGAAGTCACGGAAGAACTTCGTGGTCACATTGCGGCCCA
AGGACTGGTACTATCTGTGCAAAAATTACTACCTCGAAGTACAAGTTTAGTGGAATGAATCCATTCACGATTTTGAAGTACTCGTACGATGGAAAGGGTT
GGAGCCGATTGAAGACTCCTGGGAGCCCGTACAACAACTGAAGAAGGACATACCTGTCCTACTAGCTCAGTTTGCAGAA