Description :
From Genome Similarity Track
Location :
Scaffold_118:196- 2407
Transcript NameFunction/comments
g6180.t1hypothetical protein

Sequence
2211 bases(100 bases per row)
TATTGCATCAAAGTGGAGCTCAATGCCCACTCATTCGCGAATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGAATCGGTGCCTCTGCAA
CCTTCTGTTGGAGCGCGGCGAAGCTTCGTTTGGCTGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACAC
TGCGAAATCCTGGATGAATCGACTGTAATAATTCAGCGCACCGAGGAAAGATTGCATCCCCTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTC
ATCTTCTTGGTGTCGGCTCGAATACCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATAATCTTCGTAAAGCTCACACTAA
TGCGACATTCGGTGAACCGTCGGAGCAGTCGGTCTAGCGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATGTCATCGACAAACGACCGCCG
GTCGAACACCGGCACCAACAAGGATTCATCCGGTTCTCCGGTTGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACC
GAGGATTCGCGGTCGGCCTCGAATTTGGTCACCCGAGTTGTTGACTCCTCGAGTCGTCGCGATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGT
GGGCTTCGGCCGTTCGCATAAGCTCCGAAAAGCGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCAATCATTCGTTGGTAAATCAT
CGGTGCATTCTTCAACCCAAACGGCATACGAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATA
GCCCAGAATCCACTGGCCGCATCAAGTGAGCAGAACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCG
CCGTCACTGCATTCACCAGCTTGTAGTCGATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGACTGTCTGA
AAACGCCACTAGACGAGCTTTCAGCAAGCCTTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTCCTCCGAGCTCTCTGTTTGATGGGTGGA
TGCCCCTGTACGTCAATATCGCACACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAACACCGCAA
CGAGACTTTCTTGTTGACGGGCTGTCGCGCTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCAGTCAGGTCCGGTAAGAA
CGCCAACTCGTGTGCATAGTCCGTCAACTCGATCTCATTCGCTAAATGTTCGGACGTATTGGTATCGGTGTTCCCACTACCTGAACCGTCCCCCGTGGTA
ATCTCATGCATCATTGCTACGAAGGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTCCTCTTCACTCGTATACGTGGTATCCG
CGCCATCAGAGGTGTCGGTCGCCACCGAGTCGTCATCTTCGTCGACCCAACTACCTCCAACGGGTTCGTCAGAGGATCGCATCGTAAGTCGTCAACGGCA
TTCGGTCTCGTTCTGTCGGTTCCTCAGTACTCCTATCTGCGAACGTTATCTGGCCCTCGTCTAGGCCTCCCAAGTCGTCGGATGGTCGAGGTAGGATGCC
GCTAGGTGTCGGATAGTCTCGTCGTTCTACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGA
CACTCCGCGTACGCCAGGACTTGCCACTCCTCATACTTAGCGGAGTTCAAACGAGTGTATCCATCTCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCA
GTACCGATTCGTTGTCTCGCGCAGTGAGCAATCTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTACAGTGGGCA
CCAGGTTTCCAATCCGGCGTGCCCACACATCATGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCAACAA
ATCTTCGGTCG