Description :
From Genome Similarity Track
Location :
Scaffold_740:19589- 21092
Sequence
1503 bases(100 bases per row)
GGAAACCCTGCGTATCAATACCATCCAGCAAAACGTACAATGGCATCCTCGACAATCACTATGACGCCTACGAGAATAACGCCTCGGAACTATTAGCAGC
GAagttcaaggagctgcaTGAGACTCTGTTTGTGACTGTAGAGCACGATCTGTGGACTAACAAAGCCAAGAACTGCATCGTGGGCACTTCCTGTAGCTTC
ATTGACCACCAATGGAAACCCCGAaaacttgcgcttcttgtctAAGTTAAAAATGACGGTTAAGATTCAGAAGAGGTagcggcgttgctggacaaTCATC
TGAAGGCACGATACGGCTTGAACGTGGCAAAAATGGCCCGTTTTACGATCTCAgacagcggcagcagcgcgaaaaGTTTCGAAGCAGTTTGACACCACGC
TGCAAACAGATTGCGCGCTGCACGCGCTTAATCTTTGCATCAGCTATGGTATTGGCTTGAAAGAGAACATGCGCAATACTTATACGAAGCATCCAAAGAC
CAATGAGTTCGTCAAGAAGAGGGTTGTTGTGACTGAAGGAGGAGTTTTCCCGAAAGGCAGTGCTCTCATCCGGAAATTGCGTGCTGTGAACAACTTTTTC
GCTTCGAGTAGATCACCTGAACGGATCGCTCGCTTCACTGAAGTTAAGATTTTCCATAAGCtgccacgaccagcagctctggtGGGCGTCGACGTCCAAG
TAGCATCCACCATTAAGCTTTTTCGACGTTATATTATCAACTACTCAGCATTCCAGGCTTTTTTTCCCGGAACGGCGACGTAACGAAAGCGGAGAAGAAA
ATCTTCAACGGAGGCTGAGTGGGAATTAGTGATTAAATTGGAGGCATTCATGCAACGGGAAGCGGGGCTAGCTCTTGTCGAGTCTCAATCGTCCAACATG
ATATCTTCCACGATATACGGGTTGCTGTGCGTAGCTTCCGCCCAGATGAATTCCTACAAGTTTTCAGCGTTTTGTCTGAAGGGCACTCGTACTGCGGACA
CTAACGAAAAAAACTTTGTACGCGTTCAGCTAGAACTGACTGATTTATCCGGCTTGGATCAACGCTGTATCAAGCATACGCTGCACCAGATTGCGGAGCG
GCTACCGAAACCGTCTGTGCCAATGGGGATGGCATTACTCCTTGATCCACGGACCAAGAGGTCTGCGAAAAGCTATCTGCGTATCCCCGACATCGCGGAC
GCAGTCACCGACCAGATTCTAGAGGAGACGAAAGAACTGTTGTGAATTGAACACCGCGTGTTCTATAAAGCCTCTCACGCAAACGAGGAACAGGGCGGCG
GTGTAACGGTTTCTGCATCGAGCTCACCACGAGGAGAATGTAATAGCAGTTCCGACACCTAGTCAGATTTATTGTGCGGTGGAGAAGTCTCTCAGCCTGC
CGAGGAGAAACCCGCCGAAATTACGCTGAACGCGAAGGCGGATGCGTTGCTAGGTGAGTGGTTGGATTATTGAATAGAGTGGGGGGAGGTGGCGAAGCAC
CAG