Description :
From Genome Similarity Track
Location :
Scaffold_234:19585- 25676
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_234-snap-gene-0.29Malonyl-CoA decarboxylase (MCD)
Pytul_var.sporangiiferummaker-pug3_contig_234-snap-gene-0.30CDS Pa_1_21730
Pytul_var.sporangiiferummaker-pug3_contig_234-fgenesh-gene-0.6Transmembrane protein
Pytul_var.sporangiiferummaker-pug3_contig_234-snap-gene-0.31Cell cycle checkpoint protein RAD1

Sequence
6091 bases(100 bases per row)
GAGCCCACACGATAGCGTCCTAGCATCTCAATACTACTGATTGCACATACCAAGTCGTCGCTTGAGTTCGATGATTGTGCCAACTGGGTGCACGGCTTCG
TATCGAATGATCTTCTCCAGTAGCCGTCCAGGCGAACGTTCGTACGTGACGCGCTCAAGGTTAAGGAATCCGACACTGAACCAGGATGCGAGGAAGTTCT
ACACAAGCGCAGGCACATGCACCAAGTCCTTGAGTAGTTGTGAACAGTCCATAGTTGCACAGTTGCATCGACATACCTTCAGGCTGACGTCAAGAGATCG
CAGCGCGGCGGCTTCAGTGCTCTCCAAGCCCTTCTTGCGCAGGATCTGCAGCAAATCCGCGCGCATGTGGACCAAAAACAGCATTCCGCCTTCACGTTGC
GACAGGATTTGCTGGAAAAAGGTCTTTAGAATAAAGCAATAAAGCAAAATGAATGGATGTAAACCGCATGTGTGTGTGAGTAAGAGAAGTGGTCGCACAC
CTCGTACAAAGGGCTCAGCGTCTGACGCAAATTGCGGAACGTGCGCAAGTAGCGCTCGATGTTCTCATGCCCCCAGTCGATGCTAAGAGCATCGTTGCCC
TGCACTTTGGCCATGCTCTCGTGGAAATACGAGAGATTTTGCTGCAACTGCACCATGCCAAAACCACCATAACATTCAGCGATGTCGCAATAGAACAGAC
ACATTAAACATGTATACACTAGATGACAATTTGCGACATACGCACCGCTGTTGTGTCGACATGCAGATCGCGCGCCAAAATGAGCAAGAAATGCTTCTTC
TCGTCGATGTTCAGCGTGCGGTACTTGGAGCAGAGGCTCTCGATCACCACGCGTGGCACGAAGTCTACACATACCACCACATAAACATACAAGCATCTGC
ATACATAAGCGGGGATCTCATACAGATATGTGTTCCCATTCAGCACGTCGCCATCACGTACCGCCTGTGTTTGCCTTGGTTTTCACGACCTCTTGAATCA
TTTTTGCGAGTCGCTGACGATCTTCGGCACTCGGATGGTTCAGATCAATTTGCTGCAAGAGCGATGACGGCACTGCCGTTGGCTTTGCGCTGCTGCTACC
CTTATCCGAGCTCCCGCTTGAAAAGAATCGGTTTGGCGCGACAGCACCATCAATATTGTGACTGCCGTATTGCGGCCTCTGCAGCACTTGGAGAAGCGAG
CGAGCAACCGTTGCGTTCGCTGAGTTGATGCGCAGATTGTGAGCTACGCGATCGCGCGCCATTCGGCCCCACATGACGCACGGTAGCGCGTAATTCGCAC
GCACAAGCAGCCTCATTTTCAATTTTGATCTCCTGCTTTTCCCCCTTGTGTTTGATTGCACAACACATAAAAAGTGTTGTAGACACTGTCGATAGACACA
TCGAACCTCGCACTTGAAGTTTGAAAAAAGAGGGGGTACAATAAAAATGAAATATACTGTGAAAGGATTAACTGTACCCCATGGAACCTGTTGAAGTTGA
AGAAAGTAGATGGATAAAAAAAGACAACTAGGCTTTTAAAACGCTTCAATGATTTAACGCGACTCAATTGTGTAGAATGTGCGCACGGTAGACGAACACT
AAAGCACAACAGCCCACTGGTCATCGTCACGCGTTGGTCGTTGGACTTCCAACGGGTGGTGAAGCCCCGTGGCCTCCTCGTCTCGAGTGGAAGGCATGCA
TGGCTCAGACGGAGAAACTGTGCCAGGAGGATCACGCGCGTTGGCATTTACCCGCTTTACAGGCACAGCAGAGGCGTTGATCGTGCGGTGGCGTCTTCTT
TTCCATTTTCGTGTCGGGACGCATTGCGTCGCGAAGGCCGAACAGCAGTTGTAGCTTGGAATACACGCGCTCGAGGTACATCTCTTCATCAATCGTGCAC
GACACGTTGCCTTTGCACTTGCGGCACGCTTGGTTCCACACGATGACATCAAACTTCCACTCTGTGCCCGTCCTTACAGTGAAGATTTCCGTGAACACTT
TGCCACTGGACCATCCTGAGCACACTGCCTTCGGGCAATTGAAACGACCGACGAGATACGTCGACGCGTAGTTGTGATCACCGCCTGCTCGACGACCAGC
GGACACGGATTTGTCCTGAACCATCGGGATCTGTACGTGCGGCTCGTCCTCGATCATGCGCAAGCTCATCTGGTTGTTCAGACGATGAAACCGCGTCTGT
TTGCGCTTCTTGCCGATCGATTCGTCCTTGCCGCTCCATCGCTCCACGGCGTTACGATGCGCTTGAAAGGCGCTCATGCTGGTGCGTTCTTTTAGGGTTG
CTCCTTGACGCACAGAGTGCGACGTTGTAAACGAACAAATCTCCAACTGTGACAAGTGAGTTGATGGGTTTTGACCACACTCGTAGTCTTTGCGTACGCA
GCAGAGCTCGCTAGTAAAAGAAATGCAATAACTGCACTCTTACCATCGTTTGTTTGCCACTTGGCATTTACCTGCTCGACACGCACAGCGGTGCGCTTGG
TCATGAGGTGCTGTCTCCTTGCCATCAAACTCCCAATCGTTGCGAAGCGCTTTTCGAATCCCAAAGAGCAGCGCCAGCGCGACGTTCAAGCGGTTGAAGC
GTGTGCAGCTGCCTTCCGCTTTCCATCGACACTGGTCGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTAGTCTGCCTTCACC
TCCGCGTAGCGTTGCTGGTGCTGACGCTCGAGCGCCTGCTGACGTTCGTTCTCGTAGTACGCTTGCTACTGCCGCTGTCGACACACATGCTCCTGACGCT
TCTCCTCTTCCTCTGCATCGCGCGCCTGCGCCTCCTTGGATGCGGAGATGCCCATGTCGAGCACGCACAATGCACACCATACGCACACGACTGCGACAAG
CACCCTTGGCAGCAGATCCATGTGAGAATGCCCTTGAGGCCGGAAACTTTGGGTTCCTTCTTTCTTTCTTTCTTCCCTCACGATCAACTCACTCGATCCC
AAGAGGTCAGACGAGTCTTGCCTCAAGGCGCAGACGATGCACTGCTCTAATGAATGGGCTGAAGACGTTGACCACACACAAAAAGACACACCAATGCCAG
CAGGTGGCTCATCAATCCTGGAGCCATCGTGTGTACCCATTAACTGAAGGCAAGCAGAGCACGAGATACATCGAATATGATTGGCTGAAATAGCTCCATA
ACGTAGTTTACGAGATGGCAGTGTACTTTACTTCGTTTAGGCCTAGCTAATTCCATTCTGTAATAGCTGCCATCTCCAGCCTACAGAACGTGTCCATCTT
TTCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGCTCCGCTCACGTCACTGGGTTCGGCCGTTGTGTTGCTGCCAGTAGAGGCCATTAGAGGCCATT
AGAGGTCATTAGAGGCATTCATTGTAGCGGCCGCACATTGACCCTCTGTCTTCAAGATCTAGTCCATTGTATAGCGAGGACTCAGATCCAGCGTATCTGA
TTCTTTCCCATATTACTCGAATATGATTGGCGGAAACCACGAGCAGCTGGCTATTTTTGGACTGAGCCCCCCAAGAAGCGCGTGCCGTGTCATCTGGTGC
CATCTGGAGCTCTTCCTGGACGCTCGCTCGCTGGCCCCACNNNNNNNNNNNNNNNNNGCCTCGCAGATATGATGCTGCGCACCGGATGGAGGTACTCGCG
CACCGCCCACGCAGCCATTTCCNNNNNNNNNNCTGCTAGCTCGCTGTTGAGTCGCGGTCGCCGTGTCGTGAGCAGCGACAGTTGCGGACTCGTCATGCGC
CGCGCATTCGGTACTAACGTTGTTCCCGCACCCTCCTCCTCTCCTGCGCCTAGAAACCAATCGGACCGGAGGATGACCAGCAGCAACAANNNNNNNNNNT
GACTGTCGTGGACGAGAGAGCGCCGCTCACGGGGGGCGAGGTTCCGATCGTGTCTTCCAAAGTAAGTAGCATACAAACAGGCGTGCGTGCTTTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTATATGTATTAATGCACTTTTTGCTGTATGAACGACAGACTCAGATGAAGCATGGC
GTTACTAGCGCAAAGAAGGCATCCTCCCACCTCGAGTCAACGTCGCTCCATGTCGCTGCGAGTGACGATGAAAGTGTCCCAGACCCGCAGTTGTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACGGACGCGTCGGCGTGTGTACGCACATCGTACTGTCGATTGCGTCTTTCTCCACAATCTACG
TCGTGGTCTCCAGCGGCGTCGATGTGAGTGCGATGCTCAACGCCGTCGGATATTCCGTGGGCGCAAAAGACTCGACTACGAACTCTGCAGGCTCGTTTGT
GATCGCGTACGCGATGTACAAGCTGCTATCGCCTGTGCGGTGGCCACTCACGTTTGCTGTGACGCCCGTGGTCATGCGCGCACTGCGCAAGCGAGGGTAC
ATGCTCCCTGCAGCAGCAGCGCAACCGTCGTCCCGTCGATCGTCGCCTACACATAGTGGCCCAACCGACCACAAGAAATAAGTCTTCGTATGTATAAGCA
AAGAAAAAAACCCACCAATAAATAGTAAACGCATGTCCATTTAAATAGGTGTGCGTTAGTTCTTGTAGCTGTCAGCGTCTACATGGACGTGTCTTCTGGA
CTGATGAGCGCGTCGACGAACGCCTTTTCGCCTGTGCCGCTCTCGATCATGTGCTGCACGGAGAGGAAGCCGTCTGCATTCATGCGCAGGAACGTCTCGT
TTGAGCTCGCGAGCGCCTTAAATGCCTGCTGCAGCACTGCGACGTGGAATGTCGCCGCGCATTTACCACTGTCATCGTCTTCATCAGTGGCAGCACAGAA
GAACTCGATAAATGCCTTGGACGTGGCGCCAAATTCGATCTCGCAGGAGCCCGTTTCCGACGTCGCGCTGAGACTGAGGCACTTGTGAGACTTGGTGCGT
GCACGCGCATCGTTGCCAAACATCGCGATCGTCACGGACGCTGCGCTCGGCAAGTCGTACAGCTCTGCGAACGCGTCGTGCAATGGCTCGGACTGGATGA
TGCAGCGTCCGACCACGGCCGAGTGTTCGAACGCGCTCTCGAACTCCAGCTGCCCCATATCGTTGCCGTCGTGCTCGAGCACCTGCATCGAGCATTCGCA
GATGACGCCATTGTCTTCAACGACAAGCAGCAGATGCGCTCTCTCCGGGTCGTAGCTCATACGCAACGACGTCGTGGGCAGCGCGCTCGGGCCAAATATT
GACAGACATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCAGCGTATTCAGATTCAACGCAAAGCTCAGCTGCAGGATATCGTCGTCGTCTTCGT
CCTCATTNNNNNNNNNNNNNGTCGACGACTGCAAGCTCGTAGGACTCGAAGAGCTCGCTAGCTACGGATGTCTTGATCTGCAACGACTTGCCCTTCGAGT
GTGTAGTGAACAGAATCCCGTGACAGTCGATGTCGCAGCGGATGCGCTGGTCTTTCCTACCGGGAGACGCCAAGCAGCTCAGCAGCGTCACCAGGAGTTT
CACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCCGCTCGCTGTCACTGCTCTCGCTGTC
GCTGCGGTCCTGTCTGATGCGGCGGCGATGCGGCCGTGTCGTTGCGCCCTTAGCAGCACCGTCGTCATCACTCGCAGCTCGCGCCATTTTGCTCTTTGGA
CGAAGGTGCTGGCGCCAAAAAATGCAATCAAGGCGTATTTGTACCCCAGGGAGAGAGATACTATGCTTTATTATGTCTTCTTCAGTAAGCGTGTATGCTA
TTGCAGAAGATGCATGGTACTCTGTGTCGTTTCAGAAATAGGTAGATGGCTACACTTTTTACAATTGGGACTCAGCGACGAGCTACGCAGCCGAAAAAGA
AATGCTGAAGGAAGCGCCAGCACCAGGCGCAATCGCTGGGTACGAGACGCTCACACTACTAGGCAGCGGCCAGTACGGTGATGTGTACCTC