Description :
From Genome Similarity Track
Location :
Scaffold_54:195837- 197903
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G013741Similar to mnmG: tRNA uridine 5-carboxymethylaminomethyl modification enzyme mnmG (Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966))

Sequence
2066 bases(100 bases per row)
GTACGACGTCGTTGTGGTCGGCGGCGGCCACGCAGGCTGCGAAGCCGCCGCGGCCGCAGCACGAGCAGGTGCGTTTGTGATGTGCTAAATGCTAAAAATC
AATGCTCTGTTGCGTTGTGATGCTGACGTGTATACCTGCGGGTGCTGCCTACTGCTGGCATTAGGTGCCAAGACCGCGCTTGTGACGCAAAAGCTCTCGA
CAGTCGGCGAAATGTCGTGCAACGTATGTCATATATACCTTTAGAACCTGCGATTGGGGCCGTAAGCTGATGTGCACTGCCTGATATGACTGTAGCCATC
GATCGGCGGCGTCGGTAAAGGTACGCTCGTGCGCGAAGTGGATGCGCTCGGCGGCCTCATGGGGCGCGTCGCGGACGCCGCGGGCATCCAGTTCCGGATG
CTCAACTCGGCCAAGGGTCCTGCGGTGCGCGGTCCGCGCGCGCAGATGGATCGCGATATCTACCAGCAGACGATGCAGCAAGCACTCCGCGGCGTACCGA
ATCTGACGCTCGTGGAGGAAGGCGTGGACGACCTCGTGTTGTGTCCGCACGTGGGCAAGATTCAGGGCGTGGTGACGTCGTCGGGCCGCACGATCGGCTG
CTCCAAGGTTGTGATCACGACGGGCACGTTCCTGCGCGGCATGATCTACCAGGGCCGCGACATTCGCTTCCCGGCGGGTCGCCACATGCGTGACTGCAAT
GGTCTCGAGCCGCCATCCGTGGGACTCGCCAAGACGCTTGAGCGGTTTGAGTTTCCGCTCGGTCGCTTGAAGACTGGGACACCGCCACGACTTGATGGCA
ACACAATCAACTATGATGGCCTCGAGATCCAGCCGAGCGACGATCCGCCCAAGCCGTTCTCGTTCCTCCATGACTACCGCGACCCCGTGCCGCTGCACGA
CAAGCAAGTCGTGTGCCACGCAACGTACACAAACGAAGAAAGTCACCGCATCGTACGCGAGAATCTGCACATGCTGCCCGAGTACATTGGCGGCGACGGT
TTGGGCGTCGGGCCGCGATATTGTCCGTCGATCGACGCCAAGGTCGTGCGCTTCGCTGACCGCACGCGGCACCAGATTTGGCTCGAGCCCGAAGGTCTGA
ACAACTCGATCGTGTACCCAAATGGGATCAGTACGGCACTCCCGGCAGATCTCCAGGTGCAGCTACTGCGAAGCATCCAAGGGCTTGAGAATGTTGACCT
CGTGCGTCCTGGCTACTCTGTCGAGTACGACTACGTGGATCCGCGATCGCTGATGTCAACGCTGGAAACGAAAAAGATCTCGGGATTGTACCTCGCGGGT
CAGATCAACGGCACGACCGGGTACGAAGAAGCCGCGGCGCAGGGGATCGTCGCGGGCATCAACGCTGGTCTGGCGGCACTGGGAAAGCCGTCGTTCGTGC
TTGATCGCGCCGATGCGTTCATCGGCGTGCTCATCGACGATCTCGTCTCGCTCGGCACGAACGAGCCGTACCGCATGTTCACGTCGCGGTCCGAGTACCG
CTTACTGCTGCGGCAAGACAACGCCGATTTGCGTCTCACTCGACGTGCTTTCGAGCATGAAGCGGGCATCCCCGAAGAGCGCATGGCGAAACTCGAACGC
AAAGAAACCGCGATGGCGTATGCGCGTGACGCACTCGAAGGATTTTCGTGCGATCCGCACCAGTGGAACAAGTACGGCGTCAAAGTCGGACTCGATGGTG
TCAAGCGCACTGCGGCGCAGATCCTCTCGTTTGCGTATGTGACGCCGCAGGACATTGAGACGATCTGGCACGAGACGCAATACGAGAAAGCCAACGCGCT
GTGTGACGACGATATCAAGGAGCTGATCAAGATCGAGTGTCTGTACGCGACACAGTTGCGGCTCCAAAAGCAGGAGATCGACGCGTTCCGCAAGAAGCAG
CACGTCGAGATTCCGTCGTGGATCGACTACGCGACGCTGCCGATGATCTCGAACGAGGAGAAGGAGAAGCTGAGCCAAGCCAAGCCCACGACGATCTATG
CTGCGAGCCGCATCGCGGGCATCCGATCCGCGACGCTCCTGCTGTTGTACCAGTATGCGATGCGCA