Description :
From Genome Similarity Track
Location :
Scaffold_42:195833- 196835
Transcript NameFunction/comments
g17362.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TACGGCTTCAGCCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCGCGGAGCAAGCTTGCTTACTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAAGAGAACTAATGAACCAACTTTGAA
TTCATTTGTGTTTCCGCTGCGGTATTGTCGGCGTTCAGCTTCTGTCGATCGACAGAAGCTGCTATCGCGTCCTGGACAAACTGAATTACGGCTTGTCGGC
GCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGTGCGTGATGTTCGTTGTCGTTTAA
AGTGTCTACGCCCGTCGTAGACACTGTGTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATGGCTTGTATCAGCGTGC
ATATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACGTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGTATTCA
CGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTA
GCTCTTTATGGTGTCAACTAACACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGACGT
GTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACA
GACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTT
GT