Description :
From Genome Similarity Track
Location :
Scaffold_71:195809- 202565
Transcript NameFunction/comments
Phyra_96322PREDICTED: transmembrane protein 19
Phyra_82400Hypothetical protein
Phyra_82401Hypothetical protein

Sequence
6756 bases(100 bases per row)
TACGCACTACACGACATCACAAACGTTAGTCTCCACCAATGGTCAATACATCAACAAAGACCAGAACGTACCTCATGACAGACTGTGCATTGCACGCTTT
GAGTTGAGAAGAGTTTGCCGATGGTCTTGTGGCAATATGAACACACGTTCGAGTCTTCACTCTCGTGTATCCGCGTTGCAGTCGACTGTTCCGTCGCTGC
AGAAGACGACGACGAGGAAGAAGATTTCGACGCTGCGAAGGCTTTGCTGGAGTCCAGAGCTCGATTGTCCGCCGCTGTCTTGTGCACGTACCAGCGCAAC
TTCTTGCCTTCAGCGCACTCCATCGGAGCTCCCATGCCCACGATACTGTTTGCAATTTCTTGCAGCGCGAAAAACGACATGAGCGTGCCTCGAGGGTCGA
CCACTGCGTGCGCGAAAGACTCCACCAGTTGGTCGCTCTGTTGTCGATAGATGACGCAGAACGACATGCTCGCTCGCACGATGTCGAGGTGTTTCAACTC
TGGTAGACCAGGGTGAGGTACGGACTGGGCAATGCCGTACCCGAGGCTCTCCCCACGCGAGGTGGTTGCAAAGCCTGTGTTCACCAACACGACGTAGTCT
CGCTGCTTCACGATAGCTCCGAGCCCTGGCGCGGAGTAGAGCAGCCAAGCAACGCCCAGGAAGTCGAACGGATTGGTCTCGGTAGGACCCTCGAGCGTCC
CCAGCATCACCAAGTCGTCCATGCCGTCTTTGGCGTAGATGCTCCGCCTCCGAAGCGAGGTCGTGTCCTGCACGAAGTTGCCGTACATGACGTCGTCCAG
TTTCCCCTGAACAGTTCCCGTACACAGCACGACGGGGATCTTGGTGGCCACCGAAAGCGACGACGCAGGTCCGATCAGCAGTGCGTCGTCTTCCACCTCG
AAAGGGTCAGCGGACGACGTAGAGGACGCCGATTCTCCCGGAATCGCTGCTGCCGTCGTCGACGCAGTTGAAGTCGAGTCCGTGTCGATACTACCCGATC
GTTTGCGGTACACTTTCATGGCGCCCTTGGTCCGGACGTGCTTCCATCGGCGCGAATCAAGCGACTGCTTCCTCTCGTACAAAAAGTTTTCATACAGCGC
ACGCGTTTCGCGGAAGCTTTCGTCGGCGATACCGCGATACTCGAGCGCGTCGTCATCGGTTAGTTCCACTTGAGGGAGCACCGTCGAACCGTTGAAGGTA
CGCGACGTCCTGGCCATTGCAAGTCTGCTATTGCGTTCGAGAAGCTTCTTCTTTCGCGAGTCGACTTGAGAACTGGGCTTCCACTTGGAGAGTGACCACC
ATGTCTCCGTTGACCGCAGAGAAGCAAGCCAATGCAAGTACCACCGACGGAGAGGCAGGACGCTGCAACTTCGTCGGGTTGTGGACGTGACCTGACTGCA
ATCGAGGTGATGAGAGCCGCTGGTGTCTTAGGCAACCAGGTGCATGAACGTAACATTTGAACTTACGTAGATTTCGGACGGCGTGGTGTTGTTGCTTCGC
TACATGCAGTGACTTGACGTCGGCGACTGCAAGTTCAAGCTACCAAGCAGCAGTAAATCTTCAGCATCTGCCACGCCACGTTACTGATCATGGGAACAGG
AACGTCGCCACGAAGCCGCTGACGGCGGTGGTCACCAGCACGGACACGATGTTGATTTGCTCGTTGCTCAGCAGGTTGGCACCGCACACGTGCTCCACGT
CCGCGTGAGTGGATGACTCATCGCAGATTTTGCGCGTCGACCGGTCGAAGTACGTGGCCTGCACCGTCGCGCCGAGCACCGAGTCCAGCACCGAACCGAA
GAGCCCCGTCACGACGCCCAGTGTGATCACCTGGAGCTGCGCCGTGCCGGACGCCAGACTCGCCGCGTAGTGCAGCGCCCCAATGAACGCTCCGCCCAAG
GCCGACACGGCCAGCCCCAGAACGGACACGCCGCCGTTGGTGCCCGGCGGCACGCGCCGCAAGGTCGTGATGAGTCTCGGCTCGCTCTTGCTGAGTACCC
CGAGCTCGGACGCCCATGTGTCGGCCGCGCAGCAGGCGTAGTGGCCGATGTAGCTGGCCACCAAGTAGCTCTGGCCTGGGGCGTCCTGGAAGTTGAGTGC
CACGTCGGCGTCTCCGAATTGCACGACCGAGTAGACGGCCAAGAGCGTGGCCAAGAGGCTGCAGGCCAGCACTTGACCCGCCGAGCGTTGACCGCCCGGC
TTGTAGTTGGCGTCCAATTGCTGCTTGACGCTCGCGCGCACCTTGGTGAGCTTGCTGCCGGAGAAGTAGAAGCCCAGGAGTAAGAGGCCTGCATCGGTTG
CACGTTAGCGGATACTTGGCCAGTCTGTAGGAATTAGGTCGTACCGAAGCGGTAGCCCGCGGCGAGCGTGAAGAAGCCCACGAAGCAGGCGGCGGCCGCG
CCCGACACGTCCAGTGACTGCTTCTTGAGGCCGCGGCGGCCCAGACCCCCGGCAAGCAGCGCCGCCACCAGCACACGGGACAGCGGCACGAGCATCTTGT
CGATTTGACCACGAGCAGCACGGCGGGATGGATTCCGCGTGTATACAAAATCCTAGTCGTTCCGGCCGTTACAATGAACCCATCGACGGCCGAGAAAGGC
AATGGTGCCAATGCCAACAACAAGGAGCCGGTACGAGGCGACTCGCCCGTGAAGGGCGGAAGGCAGAGAGGTCGGTCGCGTTGTGTCTCGTGTGCAGGCT
GTTGCTTAGGAACGCGCGTCAACTTCGTCTATGGTCCGCCGCCGATCTTTGTGCGGAGTCGGCGACGCCATGCTGCTGCGCGTTGTGGAGATCTCGGTCG
ATTGACACGGCTCGCACTGCTCAAGCTTGGATAGCCTCGCCCCACGTAGCACCCTTGATGACCAGCTCTCGCTGTACGGAAGTCGATGACGCCTCCAGTG
AGCCATGTCCAAGAGCTCGCTGCGCCGTTAAACACGTTCGCGTACTCGTCGCTTTACCAAGCATGGCAGTTCTCGCGGCGACATCAACGAGTCAGCGGAT
CTCTTTGATCGCAGACGCCACAAATCTCGGCGAAGTGCGCGAGATATGTCTTCAATCGACTTGCGGTCCACGTGGGACGGAGGTCCACCCTCGTGCCCTC
TGCAGTTGAGTGTCTCGCGGCGAGCATTCGTCCATTTGCCTTGTCGCCGAGAGAACCCATTCGCCATGAGTTCTCGCTGCATATCATCCAGTACGCTGCC
ACGCCTGCGGTTCACGAAGGAGGACGTACAGCACTACCGCGGGATTTCCGATTCCTGTCTGGCCGAGGTGCTGGACAAGTACGAGAACTACCTGTACACG
GGCAAGCGCCACATTGATGCACGCCGCTGGAAGAGGGTCAAGTCCAAGGAGAACGTCGTGGTCTACAGAGAGCGCTCGACTTCCGACGCTGACCTCAGTA
AGGACAGTGACCTTGGTAGCTCCAGTAGCAACAGTTCCAGCGGTGCCGTCTACCACGCTCGTCATGAATCCACTGTGGCAGTTGAGACCGTGAGCAGCAC
GATGGTCTCAGGTCCTGGTGCAGCGCTCGCAGCAGGGACCAAGATTCCAGTCATGATCTGTACGGCCACGATGCCCGGTACGCTCGAGGACGCCATGTAC
GGGTCGTACGTGGACGACGCGGCCTCATTCCGCCGCCGTAGCGCCTACGAGCAGGACCTGGCCGACGATATCGGCATGCTCGCCACCTTCGAGCGCCCAT
CGGAGAAGGACCCGTTCCAGTTCATGGGGCTCACCTGGATCCTGCGCAGCTTCCCTGGCCTCGGAGCTGTGGTCAAACGCCGCGATTTCTTGTTGTTGCA
GCGTATCGGTCTGTCCAGGACGTCGCACGGCGAGGTCATCGGCTTCACGATCACCCAGTCCGTGCCACATCGCGACTTGCCCGAGTTATCCAAGTACGAC
GTCATTCGAGGCAGGATGTCCATGTGCACGATCTATCGGCAGATGGACGGCCAGGTTGACGTCTTCGTGCAGATTGTGATGCAGCCTGGTGGTCACGCTT
TGAACTACTTCATGATCCAGGAGACGGCGACGTCCATTATGTCCGTAAGCAAACCCATGGACGCCGCGCAGAAGAAGAAGCTCTTCTGGCTCATGAGGAA
GAACGCGCTGGAAGCTACGACAGTGGGGCTGCCCAACTCTCCAAGCGCTCGATCGGACTCGTCCTCTTCGTCGTCTTCAACGCACCGCCGCCTTCAGCGA
CAGGAGTCCGATCACTGTGCATCGTGCAAGAGATCACTCGCGAGAATCTTCTCGACCGCCGGTAGCTTTTGCCAGATCTGCCAAAAGGTTTGTTCGTGCC
TGTGTCTTTGAGGGTTTTGTGAGGTTTCCTGACGTTGACTACGATGTGGAAACAGCGTGTGTGTTCAAAGTGCAGCGTGACCAAGAAGCTTGTCATCGAT
GCAACGGAGAAGAATGTGGTGATTCGGCCATTCAACTTTTGCATCGGGTGCACGCTGACTGCACGAAGCTACTCGTCTCTGCAAGTGCACGCCGAAGAAC
TAACTCAGCGCACCCGCAGGTGAACCGTGTAGAAGATGTTAATGGATTATGAACTAGTCAAAGGTCTTCCAGCGGACAAAGGTCCTTCTTGAGCTACGTT
GCTCAGGATACATTTTTTATTCAGCAATCGACCTTGACGAGCGCTTTCTGTCTCGAAAGGCGCAGGATCAAAGCAGTTAATATACTACACTATCTCACCC
TCTGCAGGTGGCTTCTTGCGCTTGCTCAGGCGGCGCTGTATCCGGACGAGCTTGCCGCCGGGTCTTCGACGTACAACACCACGCGAGGGGTAGCTGAGGA
CGATCGGTGCACACCTGTTGGGATGTATGCCGCAGTGCTGAAAGCCTTCTGGCGCGGCTGACAATAAGGAGAGGCCGCGTAGTGCGAGAACTGCTGCGAG
CCGTATGAAGCTTGGGAAGGCCGTGCGCTGTATGGACGTCCAGTTTGAGTTGATCGCCGACGCATCGAGGACGGGCGCGACCGGCTGCTTGGGCGACCCA
TGGTGCTGTGAGGCGTAACAAGTCCGAAGCTTGTCTGCTCAAGGATCTCCTCCACGACAATCTGGGAGGCGTTCCGCTGGTTGGCGCGCAGCACGCACGG
CAAGCAGAACTTGAGCGCCTTCTGGCAAATGTCACTCATATTGCCCCCGCCACCCCCGCTGCTGCTGCGACTGCGACTTCGCTCCGTCGAGGCTAGAGAC
GCCTCGGGCTGCTCAAACTCATGGATGCCCACGCTTCCGCCCAGATCCACGCCATCGTGCATCGTGTTGGCGTCATCGCTCCGCGAGAAGCGCAGCTTCT
TGACGACGCTGCAGCGCGAGCACACCATTTTGGCACAAATGGTGCAGGGCGCCCCGCTTCGGTTGAGCACCTTGCCCACGCGACGATCGCACAACGAGCA
GTTGGTCGACCACGCTCCATCGTCCATGACGGCATCTGCGTCTTCGTCGCCTATCTCCTCAATGCCGCCCATGCCTCGATCAGCGTACGTCGTCTTGCGC
AACTGACTCGTCGCTCGGCGTCGACGTCCAGCCTGCTGCGCCGCGAAGGCGATTTTCTTGAGGTGCGCGCAGTCCACGACCGAGAACGTCATGCGCAGCA
AGAGCTCGGCGCCCGCGTTCACGGCCATGAACTGCATCATGCCGCCCTGAGGGTCGTAGTAGCCCCGCGTGAACACATTGAGCGTGCCGGTGAGGCCTCC
AGCCCCCTCGGCCGGTGGCTGCTGATGGAACAACTGCACGACGGACGTGCGTGCGCGGATGACTGAGGACGAGAAGCTCGTGGCGGCCAACATGGCCAGC
GCCTTGATGCTCACGGAGTGCATGACGCGGTAGCCCACGCGGTCTCCGTTGGCCATGGTGGTCACGCCCGTGGCCTCAAGGTACAGCAAATCCCGGCGCT
TGACGACGCCCGACATGGCGTCGTGGCGCACGGCCCACTTGAGCCCCAGGAAGCGGAAGGGCTGCTCGATGCTCGGCCCTTCGATGGCGGCCAGCACTTG
GGCGTCCTCCAGGGCGTCCTCGGCGTACGCGCTGTTCATCTTCATGGCGCGCGTGGTGGCGCTGGTCAGGCCGTACATGGCGTCGTGCATGTGGCCGGCC
ACGTGGCCCGTGACCAGCAGCAGCGGCAGCTCCGTCTCGCTGGCCGGGCACCGGCCGGGCTGGATGCTGCTGGCTGCGCGTTGGGTCGCGTCCTTGCGCT
GCTTGTACGCGCACAGCTGGTCCTTCTTCTTCACGAGCTTCCAGAGCTGCAGATCCACTTGACGTTGGGCCGTCTGCGCGTCGTAGGCCGTAAGCGCGTC
GGCCAACAGCAGTTCGGCCAGGCGCGCGCACACCTGCGCCTCGTCCTCCGAGAGCGACACGGCGCGGCGATCCAGGGCCGAGAAGGGCGACAGCGTCTCG
AGCTCCACCAAGTTGCTGGCCGTGTGTGCGCGGGCACGCGAGCCCATGCGCGGCCGAGGGAAGCGCCGGTGGCGATGCACGTCGTCCATCGGGTGTGATG
TGTGCGCTGGCGCTGCAAAAGGCGACTGACCGGCGGTGATATCCGGCACGCACGACTCCGGCCGTGAAGCGGTCTATGAACTGTCCGGTCCGGGGAGCGC
TTGCATCCCTTTAGGATGACAGATCCTGACTATTACGATTGCTTTCGTGAAGGGGTATGGAGGGGTATTGTTGTATGAGGGAGTGGATAAACAGTGTTTG
TAGGAAGGATATGTAGATAGAAATATAAGATACAAGAGGTTTTGGAGCAGGTTAAA