Description :
From Genome Similarity Track
Location :
Scaffold_1:195808- 198723
Transcript NameFunction/comments
Physo_294540multicopper oxidase, putative

Sequence
2915 bases(100 bases per row)
TGTATATTCTTTGCGCTTGACTCTTTGCGGATGCCTATATGCTTTGCACTTCAATCTGTAGACATCTTTGACGTTCAAACAGCTACAAAGAGTGGTACAT
CCAAGTTCCTACAGGAAATTATATAATCTGAGGAGATAAGTGATTGAGGTGCGTACCTACCACTATTTCCTCAAAATTCATTTTTACTTCTAAGAGAGAG
GGTGATACTCCTCAATAACATCGCACTTCTGCTAGATGGTTAGCCACACACCCTTGGTACGCTTCTGAGTGCCCTTAGAACGCTTCTGGAGGCTGGGCGT
CCTGTGCTCAGTGCTGCCTTGAGTTTGTCTGTGGAAAAAGTGCGCCATGCTTTTGGCGGGATGATTCAAATGAAAATGGAATGTGTAGACCACACCGTGG
CGGTACTTCAATGTGACGGGCGCTCCCTCCTGAGATGATGTCCCTTGATATCACTAGCCCAGCGCCGACGCTACGCGGCGGTGATTTTTTTTAGTTTGTT
GGCGCTTCGCTCGCTATGCTCGCTCCGCTATTGGAGCAGACTGCCTACGCTTCGCTACTGCAGTGGCGGACCCGTTCCGCTCGCCTCGTCGGCTCGCTGC
ACTACTCTCAATGTCAGGTTAGTATTACAGAGGCCGGGGCGGGTCCTGCGGCCCCGCAATATCGTATGAGGGGGTCGCCTTCGGCGACGGAGCCGCCTTC
GCTGCGCTCGGCAGCTACTCGTACTTAGTGGGAATCGTACTTAGTGAATAAGCGTGACGATTTTGTGACGGACGGACAGCGCGTCTTTCTGATTGATTCT
TAGGATGATTCCACAAGGGTATCAATTTATACGGTCTGCAGTTTCTGGGTGGTATCTGTATTGCTTTTGAGGTTGCCGTTGGCTTCTCGTTCCCGCAAAA
TAGTACTCGTTTCATGTTAGAGTGGAGCTTAAACGCCGAGGAGATACCCACTAGAAGCAGCGCAACGAGGATGATCGCCAATGTTGTGATCCATATCCTG
AGCAGGTATAGCAGGCGACTAACTGAGACGGTCCGATTCCGACGATCCGGGCAGCAAAGTTCAACAAGTTCTCCGTCATTCGGACAGCACATCGGCAGGC
TAAGATAGATTGGCTACGTTGCCAAACGATGCTCCCTTTGAGCTCCTTTTGCTCCATGGCTCCTGCTTGTTGGGCCGTGCAGCCACTCGTGGCGGCTCCC
AACGCGTCGCCACGCTCCCAGGAGCCGACTCGAGTTCGAGAAACCTTCACCACAATATTTTCATTCTGCAATTTGCATCCTACCGTCGACAGCAACTGCT
CCACTTCAACGCACTTCGACGGTGATTCACGACATGCGGCCTGCTCTCTTCTCTGCCTTTGCAGCAGCCTTGCTGGCCATCCACCTCGGCTCCAGCGCTG
CCGATGTTGTCACCTACGACTGGCGTGTACCGCCTCATATGACGGCGTCTCGATTCAATCTCTCGGTATCAACGGGAAGCCTTCGGACCAATCTGTCATC
GACGTGGAGCTGGGTCAGGAGGTCGAAGTGCGGGTTACGAACGAGCTCAACGAGCCTACGTGTCTTCACTGGCACGGCTTGAAGCAACTCGGCACTCAAG
AAATGGACGGAACGTCGGGGCTTACGCAATGCCACATTGACCCAACGGAACGGCGGTGTATCGCTTCACACCCGACAAGGCTGGCACATTCTGGTGGCAC
AGCCACCACATCGCGCAGTATGCGTATGGTCTGCGCGGTCCCTTAGTCGTCCACGCGCCTGCTAGCGAGCAACAAGAGTGGGAAAAGGATGTCGACGGCG
AGTTCATCATCCAAATGGCGGATCTCTACCATAGACCACCGCAGCCTGTGCGTATGTGGGACAACATCCTCATCAACAACCGCGGACGCTACAACTGCAC
TGCCGCGGCGCACCACAACTTCACTGAGTGCACGGACAACCAGCCGCTGTCGCATTTCCGCTTCAAGGCCGGCAACAAGTACCTGCTGCGTTTGATCAAC
ATGGCAGCGCTGTCCCCGATTCAATTCAGCATCGACGACCACATGCTCCAGGTCGTTGCAGCAGACGGCGAGCCGCTTCAACCCTCCAAGCCAATCAACT
CGGTGACTCTCAACGCCGCACAGCGCTACGACATTCTGGTTCAAGCGAAAGGCTCGCCCAGTGTTGGCAAGCAGCAAGGCGGGAAACAAGAAGATGTTGG
CTCGTTCTGGATGCGTGCCACTGGGCTGCACGGTCTCCCGTGGACGAGAGGAACAGCGGCCGTTGCTGGCGAAGGCTACAACTACGAAGGCCTCGCGATT
GTATCGTACGAGGCTGAGAGCGACAAGGAGCCGACATCTCAGCAGCAGATGAACACGACTACCGTGAGCGAGTATGACTTCACGCCTCTCGTTCCCGTGG
TTCTGCCCTCGACACCGTCCGACCGCGCTGTTCTCCAGCTCAAGATGCAAAACGGCTCGGGATATTTCGCGATCGATGACGGTGACTTCAACCACTTCAC
TCTCCCTAGCGACCCACCGCTCTACTCGATTGCCGCCGGTCTGAAAACCGAACAGCTTCCTGCCTCGACCAACGCGCGCAAGATTAACTACGGGGGCCAC
ATCGAAGTCGTCCTAGTGAATGCGAAGGACGAGCAACACCCGTTCCACATGCACTCGCACACCCCGTGGGTGGTAGACAGCGGCGTGGCCTCGATGGACG
CGATCCGCAACAACACGCTTCCGGCACTCCGCCTTGTAAGCCCAATGAAGGGTGACGTGTATACTATTCCTCCGTGCACTTCGGACGGTAATGGGGGCTG
CTTGGATGCCGGCTACGTGGTAATGCCGACAACCCCGGCGTGTGGATCATGCACTGTCACATCGACTGGCATCTACTAGCTGGCCTCGCTGTGGTCTTCG
TCGAGGGTGAAAAGC