Description :
From Genome Similarity Track
Location :
Scaffold_481:1958- 3797
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_481-fgenesh-gene-0.3Sodium/glucose cotransporter

Sequence
1839 bases(100 bases per row)
CACCGACCAGGACACCTGTGTTCACCCACACAGGCTTGCCGACCTCGGTCGCGTCGAGCTTGAACACGGTGCTCCACTCGATCGTGTAGCGCATCTGGTC
CTCGGTCGGCGGCGGCGTCAACAGGCTCACCGTCACGCAAACGATCATCGAGAAGACCCAGAGCAGGATCGAGAAGTGATAGAAGTTCATGTAGAAGAAA
GCCTCGCCGAAGCCGGACAGCTCGCCCTTCATGCTGTTGCCTTCGACGGTGACGAAAATCATGCGCACCAAGCCGACAATGCCACCCGTGATCAACGCAA
CGAACGCGCCAGGACCGTTGATACGCTTCCAGCCAACGCCGAGAATCAGTACGATGCCGATCGGCGGCGTCAGGTAGCTCTGGATCTCGATAATCTTCTT
GTACATTCCCTCACCGTTGCTCAACACGGGGATCCAGCAAAAGCTCAACACCGCATACGCAACAATGCTCAAGCGACCGACCCACACGAGCTGTTCAGTA
GTCGCATTCGGACGAAGCTTCAGATAGATATCATTCGTGACGACCGAGGATCCGGCAGCAAACACCGAGCCGAGACTCGACATCATCGCCATCACAATAC
TCGCCACCATCAAACCGATCACACCGTGCGGCATCAGGTTCGTCAACAGAACAGGGTAAGCGGCGTCCGTGCCACGCTCGGGAATCGACATGTCGTAGAA
GATGCTGGCAATGACACCAGGAATGACGATGAGGAACGGCGGAAGCATCTTGAGGAAGCTAGCGAGCACGGTGCCACCCTTAGCGTGAGCAGTGTCTTTG
GCGGAGAGCACGCGCTGCACGAGGTCTTGGTCCATGCACCAGTACCACACCGAACCGATCGGCTGCCCGATAAGCATCCCGGTCCACGGGTAATCGTCAT
CGGATACAGGCTTCCACAGCTCCCAAAAGTCCATGCGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACACAGCCATAACCACCAGGCCACCCGTGATGAAGACGCACATCTGGAAAAAGTCGGTGTACATC
ACAGCTCGGAGACCCCCAGCAATCGAGTACAGCGCGCTCAGCAGAATGCACGCGCCAGCACCGAGGTACAGGTTCCATCCGAGCGTCGACTGCATGACGA
CAGCACCACCGTAGATAGTTGCACTGGTCTTGGTCAAGATGTACATGACGACCGTCAATACCGAGAGGTAGTGTCGGCAAGCGGCGTTGAATCGGTACTC
GAGGAACTCGGGAGTCGTGTACACACCGGAGCGGCGGTAGACAGGGGAGAACAGCCACCCGAGCAGTAACAGCAGCAGCGCAGCATACCATTCGTTGACA
GAGACGGCAATGCCACGCCGCGCACCATCACCAGACATGCCGACGAAGTGCTGCGCACCGATGTTGCTCGCGAACAGCGCGCCGCCGACGAAGTACCACT
TCATGCCGCGGTCAGCGAGGAAGAAGCTCTGCACGGCGGCCTCCTCCTTCTGGCGCTCGTGCTCCTCATGGTAACCAACCGCCGACGCTCGCTGCTGGGA
TGCGCCGGATTGACGCTCAACGCCGTTCAGCGCCTTCTCCGGCTGAGGTGTCTCGGCTGCCAGGTAGGCTTCGCCTTCGACCGCACGCTTGGGAGGCTTG
ATGCACGGAAGCAGCTTGGCGAAGCGCGTCTCGCCCGCTTGGATCGCCGCGACAATGCCAATGAACATGACGCCGACGACGGCGACCACGAGGATGACAA
TGTCACCGGCGGTCATGTCGCCCGACGAATCGGATAGCG