Description :
From Genome Similarity Track
Location :
scaffold_1151:1958- 3597
Transcript NameFunction/comments
g11040.t1 hypothetical protein PHYSODRAFT_485491

Sequence
1639 bases(100 bases per row)
ACGTCTAAGTCAACGTCTCCTGCTGCCATTGCTCAAGAAGAGACCGGCAGCAAACAACCACTTCCTGAGGGCACGTTCGAGTTTGTGAAAAGCACGTGGA
CGTACGTTACCACTGTCGGCGACGAAGACAGACCGGACGAAGCAGACGAAATCAGGAAAAAGGTGTGGATTGAGCTGGAAAATGATGCCAAGTTGATGCT
GCTCGATGTGCTCGGAGAAATGACAATCGCACACACCAAACTGGATGCTGACGGAGCTCGAGATCTATTGCTGTCAGTGCTTCAAGAATTCCAGCACGTG
TGGGAACTCGGTCGCCAGAATCCAAGTACGGGGAATGCTCGGTCTACGCTGCAGCCGCAAAGGAGCGGTGAGCCGTTTGGATACAGGTCTGCTTTGATCC
GTGTCATTGGCAACCTGAGTTTCCGTCACACAGAGCACCAGGATCTGGTGCGTGAGGGAGGATACTTGCCCCTGTTCCTGAGTCACTGCAACATCGACGA
AGCAAATCCGATGGTCCGTGAATGGTCTTTGGTCGCTCTGCGTAATTTGTGCGAGGGCAATGAAGCCAACCAGTCGTACATCAACGAGCTACGACCGCAG
AAGATGGATGCAGCATCGCAAGTCAAGTAGTCCACTCGGCCGTACGACATGTAGAGCTGCATTGGTTTAGAACTCAGTAGATACTGCGAATTTTTCGTTG
GGATTCTGACCTTCAGCGCTTCATAAGTCGAGGTGATTGCCACCGCTCGAGTGTCGTTGCAATAAGTTGATGGCGAACGTTGCTGCTGGCGTCGGTAAAA
GCTGTGGGATCAGCGGTTCGATGCTGGTGATTTTGAGATCGCGCTGATGCAGTTGACAGTGAGTTGAGATATTGATTATGTGTACGGTGTGACCAACGCA
CCGTGAATTGAGCGTAGTTGGCATTGCGTTTCGGCGCTTGGCGTTGGAACGAGAAGGAAACGCGTAGTCCGACGAGCAGCTCTTCGAGCACGTGAGGTAG
GCTTGGATACTTCGGCAAGATCTCGCTCTGCATCTTTGAGGCTGGGACGCCCAGCAGCGCTTCAGTCACTTCGTCAAACAGCACAGCATTGGCAATAGTC
GATCCGTACAAAACCTGAAGCTGACAGCACGAGAACAACGTTTAGAGCCCCGAACGCTTTCAACTTAGTGGTCATACTGCCAACCTTGAGCCGATACTTG
AATGGCAATTGGTCTACGCGACTGAAAGCGTTGCAGGACGAGCACTGCACGCGTTGATCCACACCTGGATTGGAAGTCAACCGAGCACTCATTGAGGTGA
AGCACCGAGGACATGCAGAATATCTGCGCGCGCAATTTGAAGTCATAATCTGTGCCGATAGTGCATAAACCCATTGCGATCGTACATCATATCGTGGAGC
GAAGCCTTCTCGATCACTCCACTCGGCACGAACTCCACCATAACGAAAACAAAGGTTCCGGTAGAGTTCCCGGTAGAATCTCGTCTGCACTACGCAATCG
CATACTATGCAAAACTAAAGGATACCAGTAGAAATGGTAAGGTCTCGAGTGCTCCAGCACTTGAGTGGATGCCTCGGTCGATCGTCATTTTCCTCGTTGC
AGTCGCCACTTAACGCTCGGGTTGGCTCGAATTGGGATG