Description :
From Genome Similarity Track
Location :
scaffold_55:19576- 28630
Transcript NameFunction/comments
Pl_110961hypothetical protein PHYSODRAFT_323276
Pl_110962hypothetical protein SELMODRAFT_122498
Pl_110963hypothetical protein PHYSODRAFT_475742

Sequence
9054 bases(100 bases per row)
TGCCGCAGCATGTTCATCTGACTCTGGATATTGAAGATGATCGAGTCTACGTCTGAACCCGCTTCGCTCGGAGTGGCGTCGCCATACAACGACTCATCCG
CAGATGGAAGACGTTCCCTGATGCCCAATGATCCTCGGCCGTACATAAAGGACTCTCTTGCGGCGTCCTCGTAATTCTTGCGAGCCACGAGCTGTTCCAG
GAACTTGCATTTTGCATCCAGCTCTTCAATCTTTTGTGACAACATGGAAACGTGGTCGACCTGTTTTCCGGGCATGGCACTGCGTGCTCGGCGAGGAGGC
AGCAGCGCCACATCATCGTTCTCGCCATCCTCATCTTCTGACAAAGCGTCCACTGAGTACCGACGACGACCTGAACGCGAGCGGGATGCTCGACCTGCCT
GACTATCTAAGTCAAGTGGGGCACTCCGAGGTGGGCGAGCAATCATCAACGATTGGCGTCGTTGGTCCCGTGGAGGACGTGAGTCACTACCGTTCTGCTG
CTCCACGAGCATCTGCTGCAAGCGCAAGATTTCGTTCTCCAGCAGTGAATTGCGATCATCAACATGACTGCTGCTTGCACGGCTGCGTTGTCTGCTGTTT
GCGCGACTACGCTGTCTGGTGTTCGTGCGGCGATGGACGGGCGCTAAAATACGTAGTGGAGGCTCCATCCGGTCATCACTGGTGGAGCTGTCTTCCTGTT
CCGAGCTGGACTGGGCCGTTTGAAGTCCAATCGGCTTATTCACATGTAGCTTCGCTCTGCTCGCCGTCGAATCATCACTCGGTGATGGCTCAGCCTCCAT
TTCACCTGCAGCCTGGGACGCCTGGCAGGCGCGCCGGAACTTCTCGAAGATCATTTTCAGGCGAAAACGATGGATTTTTGCCGAAATATAGCTGTTCTGC
TCGCACCATCGCCTAGCCTGGTGTTGGATGATGATAGCAGCAGCAAGCTCATGCTTCTCCTGTGCCAACAGCTTCCGTTTTCGCTGGGCGAGCCATCGTC
TACATTGAGCTTGAATGCGGATCGCTGTAGACACCTCGAACTTATGACGCAACAACTTTGCACGATGTCGCTGAGCGAGCAAGCGTCTGCATTGCGCTTG
AATGCGGACAGCAGCAGCTAGTTGCAGCTTTTGTACCCGAAGTCGCGCAAGTTCTCGCCGCGCTAACCACCGTCGGCAAATTGTTTGAATGTCAATAGCC
GCAGCAACTTGAAGCTTTTGCTTACGAAGAACAGCAAGCTTCCGCTGTGCCAACCAACGTCGGCCGTTTGACTGAATGCAAATGGCACCAGCGAGTTGGC
TTTTATCTTTCAGCATTTCCGCAACCACCCGCTGTGCCACAAAACACCTGAAGCATGTCTGAATCGCAGTGGCTGCAGCAATCTGGCGTTTGTGTTTAAG
GATCTTGGCAAACTGGCGTTGAGCCACAGAGCGTCTCCAGCACGATTGGATCTGAGTGGCAGCATTTTCACGACGCAACTGACGCAGCTTATCCACTCGT
CTTCTTCCAAGAAAGCCTCGGACAACCGCCTCCACACGCACCACGAACCCACGCAACTCTTGATATAATACTCGGCGGCGGTACCCACGATAATGCTTCT
GTAGCACTGTCGCGCAATGGTTCCGCAACTCCACGCGGTATCGAGAAAACCGGTTGTAAGTGCTCGATTTGCAAAAGACCAGTGTCCTGCCTACCTGGAC
GTCCTTACGACGGATATCATTTTCGAAAGCAGTGCCGCTACCGTCGTCAGTGATTGCCGTAAGAGCACCAGGGTTCTTTTTCTCGCGCTCCACACCGTCT
TCCAGAAGCACCTTATCCATCAAAACAGTCACTAGCGCTTGGGCTAAGTCATGGTTGTTCATGTTCGTCGCTCGGTCTCGTGTGCTCAAAAAGCACTTGA
ATCCCGAAAACAGCTCGATAAAACTTGCATGAGCGAGACGCACTGAGTATCCATGACGCGCAATACGGACTGCCTCCAGCACACCAACGGAGCGCATTTG
CTCTACCATCCTTTCGCGATCGAAAATGCCCGGCTTCTTAACCTCATTGGGCTTGAGGCAACGAACATAATGGGCCTCGGTGCGTCCGATTTGATCAATA
AGACGGTCTAGCTGACTTTTGAACTGCGCCGAAACACTTGGTGCCCGCAGCATGGAGTATCGTCTCCGTCCAGTCGTTCCGTTTTCAGCACCTGGTAAGT
CTACATTATCATCAGATCCAATTGCCACCACCACTTCATTACTTGAAGAGGATAGGATGTCGCTCGCATGAGCAGGAAGTGCATCGGTGTTCTTCTCGAC
AAACTGTTCGACGTTATAGCATACACGACCGGCAAAATGGTGCACCACAAACTGGTGGTTCACACGCTCCATCTTAGAAGCTGAGAACGGGTGTTTCTTG
GCATCATGGCGAACAGCTTCCTCTTGAGATTCGGTTCGGTGGAGATACCGACTAAATGACGACATGAGCAGCGGCAAAGTGCTTTGTGCAAGTTGTGGTT
GTTGAAGGAGCCCAGCGGAGTCAGCGGACCCATCACCACCGTGATAACGATAGAACTTGGTGCTCAGCGCTTGGTTCGAACCCTTGGGCATTAGACATTC
TTGATCCAGCAGCGAAAACAGGCCGTTGCTTTTGTCATCAAAGAGAGCCAAACACGCTGCATTGCTCGGGTAAGATATATTCCTCCAATCGATTCCCTCC
GTAATATAGACCTGCTGCTCACGCACGAAGACGAACTCATTAAATTGTGCTTGTAGGCGTTCGTTCGCATAGTTGATGCAGAGCTGCTCGAATCCATTGC
GGTTCAAACTCTCAAAACCAAAGATATCCAAAATACCGATGCTAGCCAATTCCTCGTCTTCATCCGAAATCGAAATGGCCGAGTCATAATAGTTGATCTC
GTCACTGAGACGGCGTACAAGCCATGTAAAAAGTCGACCGTAGATAGCTTTGGCTAGAGATCGACATATCTCTTTTGCTTGCTCGGGATTATGCTTGAGA
ACCATAACTTCCATTCCAGCCTTGATTTCTCGGCTACTCAACAGCGTCTCAAGCTTGTTCGCACTGATTCCCATGAGCTCTGCACACTTTTCCAAATGGA
ATCGTGATGCCGTAGTAACAGCAGTAGCATCTTCCTGTCCACCCGCACCCGTAAAGTTTACATTCCCAAGATGCAGCAGCGCCGCCAGAATCTTGAAAAT
ATCTAATCTTTCCTGCTCGTCAACACCTGTGTCTTCAAAAGCCCGCACAGTCTCCACATATAGCTGCGCATACTTGTCTGCCACAGCTCGTTTTCTCGCA
AAACTGGGTCCGTACGAGTTGAGCAGCTCATATTTGCCTCCTTTCTTCAATCCCAAGACATCAAGCAGTTCCTTGTCTGCTCCTTCGAGCAGCTCATAGA
AAATATGGAAACAGCGTTCCTCTGGGTTCTGGTGCAGCAATCTCACCTTCTCTAACAAGTAGCTTACAATTTGCGCTCCGACAATCTCGTTCTTGTCTCC
AAATTGAATCTTGATGAATTTACCAAATCGACTGGAATTGTCGTTCCTAATGGTCTGTGCGTTGCCAAAAGATTCGAGAATCGGATTAGTCTGTAGAATT
CTCCTGCCAATTTCCACTGCACCACTTCCTTCCTGTGTCCGAGACTGATCCCGTCCCACACTGGTCAAAAATTGCATGAGAAACTTGGTGCTCTCTGTTT
TGCCACTGCCACTCTCTCCACTGACCAAGATACTCTGGTTACGTCGCTCAGGCTTTATTAAGCCACCAAAAGCTTTGCCACCAATGGCAAACACGTGAGG
TGGCAACTCTTGTCTCCCTGGAGAACTGGAATCAGTCATGAACTGTTTGTATGCTTGTAATTGAGCCTCCGAATAGAGTTTTGGCAAGGGTTTGAGAGGA
TTTAAAGCCACGAGAATGTCCCCAATAGACGTATAGATCTGGTCCTGGTCGAAGCGTTCACTTAGGGCCTGCAACAGTGCTGCCTCATGCAAATGTTCGA
GGCCTGTGAGACTTGACATGGCTGGGAAATTCGCTGCCATGTTGCGGAGGCACAACTCGTCGTCGTGGCCTGGGTAGCGACCTAATGATACAGGAATGAA
GGTGAGTTGCGAAGAGACACTTGCCTTTTCACGTTACCACTAGTTCGGCTAGTGCTAAAGCGACAGGGGCATTGCAAAAGTGAAAAGACGCAACAACTCA
CACGTGACAACGTCGCTTGTGTCGAGGCGACGAACTTGCACGAGACCGCCAGCGTCCTGGTAATCGACCACTTCGCCTGCCGCCCAGACGACAGCGTCCT
TAGTCTTGACCCACACGTTCGTGCCCACGTCCATGGCGGTCGACCGCCTTCGCAACTTGCGATCTGCTCCTTTGCGGGGGTTGTGGAAATGAGTTGGTTT
GGTTTAACCACCGCTTGTCTTGTGATGGACGGAAGAAGCAGACAGTTTTTTCCGCCCACGAAGGTGTATATAGAATTTTGTATGGGTGCAGAAAACGGCC
GCCTTTTCAAAAGTTTTTGCAACGAGATCGCGCGTTGAAGGTGCTGACACTGAGAATTCTGGCCCAGGAGATGCGCCGATGAGGGCAGTTTCCTGCAATG
GTCACCAAGAACTAGACTTGTTAGCCCGCAATTACTGGATGCAGAGCTAGTAGATGTGGCTGATGCCAAGCGAGCCAGTCTGTATTGTCCTAATTCGCTT
AAATGAATGGTCTTATTCAGATGATCTTCGGCAGCTGTGAAAACAGGACTGCTGAAAATGGCGGCGGTACGAGACACAACAGCATATTGTCAATATAATC
AATGACGCGTGCTGGTGGCGGACCAGATTGGTACAGTCTTACAGGCAGAGGAAATGAAAGGAGGTGGAATGAAACCGCGCAGAATGTTCACTCGACGCAC
ATGGCGAAACGACATAACTGAAGATACTTTCGAGCATTAGCTAATGTATCGCAATGGGCGGAGCCACCGAGTCGACCATTACAATAGCTGGGTGTGACTC
AAGGACTCATGGACAGTGGGGAGCTACATGTAGCGAGCCCGTAAATCCAGCGCGAGTTGTGCTAGCAAATCATCCTCCAGCCTCGAGTGGACGGACGCAA
ACTGTCCCCGCGCAAGTGCAGGCCCACACCAAGCCACCAAGATGCGGCTATCAAGCGCGCGACCCTTTTCTCAGCGAGTAAACTTTTCCCGGGCAAGAAC
TGAAGCAGATGGAAGAATGATTTAACTTTACGCATAATTTTCAGAGAAGATCTCGTCAGTGTGGGGTTCCTCGAGGCTGTGTATGTCCATGCGTAAAATT
TTGCATGGAGGTGGCAATGGCAACAAGACAGCTCGTGCCAGAATAGCTGCATCAGCCCGGCAAAAAATCAAATGAGTGAGAAGGCAGATGTCTGGCCCAT
GCGTAAAATTTTGCATGGAGGTTGCAATGGCAACAAGACAGCTCGTGCCGGAATAGCTGCATCAGCCCGGCAAAAAGTCAAATGAGTGAGAAGGCAGATG
TCTGGAAACAACCATTACAATTGAAAAATTGATGTTGTGATGGTGGGCTTCTCCGATCAAAACTACAATATTGCTCAATTGTCTGATAGGGCCAAGAGCA
GCACTTCATTCCACCAACCAGCTTGTATACAGCGAGTCCTTTAGCAAGTCTTGTTGGTATTTTTGAGCGCAAATTGAGTTGTATACTACCAACCATGATA
GGCGTGATAAGCTCAACTGTGAGTTCACTATCAAAAGCAATTGGCTTGCAATACTCCTACAGAGTAGTACTAGCTACAGTAAGTGGTCATGAATATAGGA
ATTATAAAATCAATCGAGGCTCTCAAAAAAGACATCGATCTCCAGTGATGAAACGAGAATAGAGTCTCCTAACTTTATTCTCACCACTCTATTCCCGCTA
ATTGTATCTCGTGTACACCACACCAGTCACTTTGACTGGCGAACGTGCCATTGTCCAAGCGTCACTGCCCCAATATGGTCAAGAAGCGCACGCTGTCGCC
GCTCTCGGTCTTCGACCAGCAAGCACTGCCTGCATTCCTGCAGCAACACGACTTCAAGGAGCTGCACGCACTGACGATCTGGCGGTACCTGGCACAGCAC
CCGGAAGCCTCGTTCTCCGACATTCCCGGCATCCCCAAGACGCTTCGGACGCTTCTAACAGAGCATTTTGCGCACTTTACAACGTCTGTGACCACGGAAC
AACGCTCTGCTGATGGGACTGTGAAGCTGCTGCTTAAGTTGCAGGATGGCCACGAGATTGAGGCTGTGATCATGCGTCACAAGGGCCGCAACACGCTCTG
TGTCAGTTCCCAAGTGGGCTGCCAAATGGGCTGCACATTCTGCGCCACAGGCACACTCGGCATCATTGCGGACTTGTGCAGTGGCGAGATCTTAGAGCAA
CTTGCACACGCTAACCGTGTGGCACCGATCCGTAACGTAGTGTTTATGGGAATGGGTGAACCTCTCAACAACTATGACGCCGTGTTGGCAGCTATTCGGG
CCATGACGAAGGTCTTTGGCCTTGCACCCAAGTACATTACTTTGTCGACGGTTGGAGTGATCCACCGCATTCGTCAGTTGTCGAAGGACGCACCACTTGT
GCGTCTGGCACTGTCACTGCATGCTCCGACGCAAGAGATGCGCAGTGAGATTGTTCCGACGTCTACGGCCTATCCGCTGGATAAGCTCATGGCAGCTATT
GACGACCACCTTGCAATGAAGTACGTGGAAATTGAGGGAGTTGTTGATGTTTTAGTGTGCTAATGGCTTTGATGTAGGGAGGGACGACTGGTGATGGTTG
AATACTGCATGCTGGCGGGGGTCAACGACTCGATTGAAACTGCACATATCCTTGGAAAGTTGCTGCAGAACCGATCGGTGCATGTGAACCTCATCCCGTA
TAACACGACGGATGTTGGTGCACAGTTCCACTCCCCGTCGCCTGAGGATATCCGTGCTTTCCACGCCGTGCTGCGCGAACCGTACAACTTGAAGGCTACG
ATCCGCGAGAATCATGGTACGGATATTGACGGTGCGTGCGGTCAATTAGCGTTGAAGAGCAAACCTGATGGCAGCGCTTCACAGCGTGACATTGAGGATC
TTGGTCCTCGACGGACCAAGGGCCCCCGCAAGAGCAAAAAATCTTCTTCGAGCTCTGACAGTGAAAGTGTGGACGCGTCTCCTGCTGTTACGTCCACGAC
CAATTCATGGATTTCCCGTGCCAATGACTTCATCGATGAGCATCAACAGGCTATCGGTGTGGCTTTGCTCGGCGCATCTATCGTTGTGCTTGCGATTGGG
TTTGCCCGTCGCGGACGGGCACACGTAAATTAATCTAGCAATACAGCTAGAGTGGAAACGAAAGAAGGCTCTACTGACCCATAGAATCCAAGCAAGCAGA
GCGGCGTCTAGCAATCTAGAATATTTCATGAAGACTTCTATTTGCCATTGCGATGGAAACTAGCGAAAAGCAGTAGATAATATCTACAGCTTGCCACCAT
ATCATAATATGGTTGCAACTGGCACATATTCATTCATCACAAATGCGCTCGAATCCCAGCTGATGAATTTAGTTGAAGCGTTAGCTGGCATGTGAGGCCC
ACCCACAAAAGAGGACAACTAGTTACTATAGCAGCGTTTGAAAGCGCAAGTATTTCCTTCTCCAAGGTTTGCGAGTATAGCCAAAGTAAAGCTACCAACT
ACTTTTCACTAGGGGTAGTTAGTTGTTCACACTCTTTCCGACACACTTGAGTGTTAAAACGCCAGTGGGTCCTCCAGTACAGTAATGTTGCGGTGTTTCA
ACGTTACCAACTCCTGATGGTGCTCCAATCCCAGAAATGTCGTCATGAGCTTGTTGAGATACAATTTCAACGTTATCAACTCCTGATGGTGCTCCAATCC
CAGGAATGTCGTCATGAGCTTGTTGAGATACACATTTTCATGCACACCCTTACACATGCGTTCTAAGATCAATGGTCCCTTGCAGTACAGATTGACATCC
GTGCCAACATGACTGACTGTCGTCCAGTCAATCCAGGCCGGAGCACTAATCACGTGGCCCAACTCGATCAAAACAAAGTACAGATCGCGTGTTTCGTCGA
CAGCAGTGGCGATTTCCGTCACGAGTTTCGTGACCATATCATCCGTGATAGATGTCACGTTCGTGTAGTTGGTTAGCATGGACTTGGCTGACTCGAGGAG
AATAGTCTTGTACGTTTCGTTGGACACTCGTCACTTGCCAGGATTTCATCGAGATGTTCCTGCATGACTTCAGTCGACATATTCTGCTGCTGTAGCTGCG
TGGGATACCATGGATACGGGTATTCCATGCCACTACGTCCAAGCGTGAGGCCACCGGTGCCATGATCAGCTGCTGACAACATGGCCGTATTGGGGGTCTG
CTCAACGTGATTCAGCACAACACCGACCGTCTCATCAAATGCAATTGCCTCCTTTCGAGTGGCCAGCGTGATCCACGCGAGAACCCTCGATCATCACAAA
ATAGCCATGCTTTTTGGCCTGCTCGTTTTTGCGTAGAAGACTGAGAACGATGTCTACCATCTCTGGAAGACTTGGTTCACGTGCAGTAGTGTCATTAATG
CCCAAATTGCGCAACCGGTCTACTTCGTAGGTCATGTGGCTGTCTTTGAAAAGACCGAACAAACGAAGTGCACCGGTGTCAGCGTTTGCCGACTGATAGT
CCAGCAGATCTTGGTAGTTGTTTGCTACCGTGTATCCGTTAGCCTTTAGTTCTTGAATCATGGAGTCATTAAAGTGCTTTTTGCCACCGCCCAACAAGAA
ATCTAGGTTCTTGTTAGCAACGTATTGTGCAGCGATATCGTCCTCAGAATCACGATCAACAACGTGCGCTGCGAATGATGCAGGAGTTGCATGGGTCACT
CGACACGTTACGATCATACCGGTGACCATACCCCGAGACTTGGCCGCCTCCAACACAGTTCCTAGGGGCTGTTCAAACGTATCCACAGCAATTGCATTGT
CGTAAGTCTTGAACCCCGTGGCGTAGGCAGTAGCGGCAGCAGCTGAGTCCGTGA