Description :
From Genome Similarity Track
Location :
Scaffold_187:19573- 22442
Sequence
2869 bases(100 bases per row)
TCGTCCGACGTGATGCGCTGCTCGTGGTGGAATTGCGCACGCAGCACGTTGAGCACCTCCCGCTCGTCTTGTTCGCTCAGAAACTCGTGCAGCTTCCCGC
ATGACGCCGCGGACCATGGCGGACGAAGTTTGGCGCGGCGGTGCTGGGCGTCTACGCCCAAGGAGGCTCGGGGCATGTCGGTCCGTTTCGTGTGTCGGAG
CTCAGTCGGACGTCTCGTCCGATTTGGAAATGACACGGTCGGCTGGTCTGCGATATGTCGTCTTCGTTCGACGAGCTTCTTTTAGCATGAGATTAGGGGA
ACGACGAAGTCGGTGGTCAATAGAAGCCTCTATTGACAAAAAATAGCGATCGGTTGGTGGATTAAGGTTGCTGGAGTAGCTCGTCTCTTCCATGTACGCT
TGTGACGCTCATCACTGGACGACGAACAAGACACTGACAAAGCGTGTTTCGCTGCGTCTAGGGGATCTATGATTGGTACGACGACATTGGCCAATGAGGG
ATAGTTTTATGCCTGCGCTTGTGACCTTTGTGACATACGAGTCGTCCAGTCAGTTTACAAGAAGCAGGCGACGAGGAGTAAACAATATGGAAATACATAA
GCTGTAGCCAGTGGTTCCTGGCGCACCGCCGCGTTTCTGTTGACACCAGCGGCGTTGTGGGAGCGCGGAGACGAGCTCACGGAATATCAAGTGCGGATTA
GCCATCGATCGACAGAAATAGGATTGAACCTCTATCATTCTGGGTGTGAAATGATGTTAGTTGTCCGAAGCTTCGGTGCTGCCACAGCGTGTAGGACACA
ATTGAACATATTTTGCCCGTGCGCCTAGGCTTGCTGGCAGAAGCTTCTTTGTCAATGGATCAGTTAACGCTCGGTGTAACCAAATCTGCATGGCTTCCTC
GCCAATTGTACCAGCCGAAGGGCGCCGAGGCTCTCCGCCGTGGTTATCGAATATCTTAGTCGGGATCATCCGGACGAAGTGAAAGCATTCGCTGAAGAAA
GAAAAAAAGGTGGCAAAAATGAGTAGTGTATGTATTACAAATCTATGGATCCAACGGAATTGTTCAACGTTCGGACAGGAGGACATACTATCACCGGCAG
CATCCAGGAATTCTGGGAACTGACTAATGTGGCAACTCCGCGCTGTAGCAAAGCGGGAGTTACGAAGGATCAAATTGAAGGTACAAGGTGCTTGTCGGCT
GTTATGCCAACGTGACCTCGACAGACAACATCGAGAGCCATCACCTCAGGTGACAAGCCCCGTATGACCACGGCCTCGCACGAGAAACCGGTGTTGCTAA
TCAGGCTTAGGATATACCAGACTTCTTGCAACCCGTAAAGGTTGAATCGACCAGTCTCTCGCTCTCTTTAGTTGCAGCTTGACCTTTTGTTTGGACTGTC
TGCTTTTCAGCTGACTGGACTTTCCATCGCTGACCGAACCTTCATGTTAAGGTGCTTGAATCCCACGACGACTTAGACTGCAGCTTGTAATTTCAAAGAT
GGAAAGAACCGAGAAGAAGCGTGCTATGTACCGACACCAACGCCCCGAATGGCTGGTATTGCCATCCAGTACGGCGAAAAAAGAGCAGCTGTAGCTCTTT
CGACCATCAATGATGGGAATCGCTTCGTGTCAACCGATCAAGCATATCTTGTGTGGTCTAGAAAATCCAGCGACACCCGACGCTATTCGATCACTCTGAA
GCAGCGTGACTGCTTACAGCCATCCAGACACACCAAACCGCACGACGCTCTCAACAATCTCAACGCGAGCCTCGTCCATGCAAGGACGAAAAGGCCCCGA
AGAGGTTACTGCACATGATACACGCCAACCCCTACCACCGCTTTACGACCTTTTCTCGTTCAAGACACCGCGTCGCTGTGCCCCAGAACGGAACATTGTT
CGTGCCGGTAACGTCGCGCATTCTACGGCTGCTGATTGCCAACCTTGGAGTGATGGGCACCAAATTTTGAATTTTTACGATGTCCTCCTGATACTCATCC
AACTGTAACTGTCTTGCGCAAAAAGACACCACCATCTGCTTCTGGTTGAGGTCGTCACAGCCACAACAATCAGACATATTTAGATAGGAGCCTACCACTC
GGCATTCCGTAGCAAGGGAATGTTGACGAAGAACAGCATTATAACGCAGTCTTCCATGAAACACGATTTTGGTCTGAGCTCACGTACAGAACACGCACGG
CTGGTCACATCGCTTTCATCGGAAAGGCAGCAACTTCGAGGTAACGCAGGCTTGCCACCGCAGCACTTCGCAATCTCTAAACCTTCCACACAAGTGATGT
CTATAAGGCTAGTGGATACCCTTGGTTGCCAGCAAATGGGTCGTAAATTCTTTTTTAATCAGGAATGTGACGATCTGAGCCTTTCTCCCTCCTACTGGCT
GCAGTGGCACTGGGTAGGGTCCTGCTCTTTTACACTGGCCCGCCTACTTCGCAGCCTGCCCCCGATCAACATTAATTTGATGTTGCTGACGTTTGGTGAT
GCAGAGGGTGGACTGCTGTTACTTTTATTGTTAATAGTGTACATTTGCATGCACTTCGTTTAGTTACAGCTCTCTCAGCATCATTCTGAATGCTCTGAAC
ACCTAACGCATAACTTCTCTCAGAGTCGTCAATGAAGGCGACGCCTCGACGTGGGTGAGAGTGCACGAATAGAGCAAGCTGCTAATTTCCTGCTTATCAC
CAATCCCTCTAGTCGTCGTGCTACTACCACTTAGACCAACAATAGAAGCTGCGCTACTGTCCGCCAAAGCGTGGCTCATCGCTACAACTAGCTTGAGGTC
TGTACGGTATACAAATATACCCCCACGCGACGCGTAACGAGCATCTAAGCGTCACAAACTCGATCAGCT