Description :
From Genome Similarity Track
Location :
Scaffold_115:195725- 197016
Sequence
1291 bases(100 bases per row)
GCACGATCAGCGTCTCGCTCTTCTTCTGGACGTTCAGCTCTACGAATTGCATGCTGTTGGCGGTTTAGCTCTCGTTCATATTGTCGCTGCTGTACATTCA
GCTCCGATCTGTGTGCTGTTTGCTGCTGTCGATTTTGACCCCTTCGTTCTAGAAGCTCCTCTCCCCGTAACTGAGCTCGTCGGGCGCGTTTGCGATCAGC
GTCTTTCTTCCTCGCACGGTCACGCTGAGAGAGTGACATAGCAGCTCGCTTCGTTCGAGCTCTCTGTGCATCGCGTGTACGCTCACGATCTGCCTGAGAC
AACGTCCTGCTAGCTCTTTTCTCCCGAGCTCGCTGTGCAGCCAAAACGGGGACCTCTTCTCGGACATCTGGGTGTGGTACGACAGGCGCCTGGAATAGGG
CCACATCATCGGTTCCAGCTTGATACGCCGCCTCCATTGCATCCGCAAAGCGCCGCTGATGTACCGCAGGATCGGATTCTTCCGTTTTCTCCTCCTGCTG
TTCCATACGATCAGCCAGAACTTCCGTCGCTTCTGTGATATCTGTCTCGTCTTGGTGCACGCTGAGGGCCTTCAGCTCTTTGTTCAAGTCGTATCTTTTC
TTTCTGCGCTTGGTCTGACGTCGTTTTCGTGCATCCTTTTCCTCTTGCATGGGTGTCGCGTTAATGCGTTCGCTCTCGCGCTGGGCCTCCTCGAGCTCCT
CGCGCGTCCTCTTTCGCTTACTCCGAACCATAGTTCTGCGAACACGAAAATGTGACGCGTTAGACAATGTCTAAGTACACTGCACGTAGCAGTAGGTTTT
CATAGAGTAGTGTGTTGGAATACGCGTACTACCCGGGATCGCTTGCCCCCATCAAGGTTATCTCCGATCACTTATCCCACCGTCACGGGCCGTGAGGCCC
GGAGCGGTTTTAGTTTGCAAATTGTGCAGTCGAATCTCCAGGGTTGGGCCCCCGGATAGTACTGTAGCTTGAGGTGCGATATCCTTTTGCCAAAAAGGCG
GCCGTTAATTGCATAGGCTGGTTATTGATAGGCTATTACAGCCCCCATCCCATCTGTCGGTTAAAAGAGGCCAGTTACGGTACCCCTCCTGACCAACTGC
ACGCACGCAATGTGCGTGCCCATCAATAATCATTAACGACCGGCTCAACTGGTTCGCTGTCGGGTTTGCGGTCAATGGACCAGGTGCCAAATGTGCTCTC
GCGCAGAGTGGGCGGTGGGATAAAGCCCCAAGAACCCAGAGGGCTCTGGAACTAAATCCCCATAGCACGGCTACCTACTTGCAGGATAAAA