Description :
From Genome Similarity Track
Location :
Scaffold_2269:1957- 5568
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2269-snap-gene-0.1Dynein heavy chain family dynein heavy chain

Sequence
3611 bases(100 bases per row)
GCTTGCCTCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAAAGCTGTATCAAGGTTGCGAATGAGGCGCCCACCGATCTGAAGAGCAATCT
GCGGCGCGCGTGGGCCCAGTTCTCGGCCAAGCACATAGATGAGGCGGTCTCGGCGGCGGCCATGAGTGACTACCAAGGCTGTCTCTTTGCGCTCTGCTTT
TTCCACGCGCTTGTCTTGGGAAGACGCCGCTTCAGCTTTCAGGGCTGGAGTCGCATGTACAGCTTCAACACGGGGGATCTGCTCATTTGCGCTGATGTGC
TGCGTCGATACGTTGACAGTCCAGCTGGAGCGAAAACCAAGTCACTGCCGTGGGACGACTTGCGCTACATCTTTGGGGAGATCATGTACGGAGGCCACAT
CACCGACCACTGGGACCGCATCACCAACAATGCGTACCTCAGCGAAGTGTTTACGCCCGAGATCCTCAAGGGAAAAGCACTCGCGGTCGATTTCCACTGC
CTCGACCCAGCGAACTCGACGTACGCAAAGTACGCGACCCATATCGAATCGCAGTTGCCTAGCGAAGCGCCTACGCTTTATGGGCTCCATACAAACGCCG
AAATCGGGTATCTCATCGACACGTCCAATGAGCTCTTCCAGACCATTGCCATGTTCACGCAGACGACGAAGGCCAGCAATTCCAGTACGTTTAACGACGC
TTCCTCCTCAGGCTCAAATCGTGTGCTCGCGGTAGTGGAAGGTTTGCTGGAACGCATGCCGCCCGAGATTGATCTGATGGCCGCTCAGGCTCGTGCATCA
CCGCTGCTGCAGGCCGACCAATCTCCTTTCGTGGTCGTCGCGATGCAAGAAGCCACTCGCATGCACGCCCTGATGAGGGAGATCCACACGACACTGCTCG
ACCTCACGAAAGGAATCCATGGCACGCTCAACATGACCGACGCCATGGAAGATCTGAGCGCGGCGCTGGCCATCAACCAAGTCCCTGGCCGCAATGTATT
GCACTTGTGCTCGTGGGAACGCCAGGCGTGGTTCTCGCGCAAGCCTCTCGCGGGCTGGTTCAGCGATTTGCTCGAGCGTATCTCATTTCTGAGTGCATGG
ACGAGCGAGTTTCGGCTGCCGTACTCCATGTGGATCTCGGGGCTTTTCAACCCGGCGGCGTTTCTCACGGCGATCAAGCAGCATACTGCTCGACGCCACG
GCTTCCCGTTGGATGCGATGGCCATTGAGACACACTGCACAACCATGGCGACGGCCGAGCAGGCGGAGACGTACCCCGACATGGGTGCGTTTATCCACGG
GTTGTATCTTGAAGGTGCGCGATGGGAGCCGCCGACGAAAGAAGGCGAGGTGACATCGTCGTTCAGCTACGAAGTGGACGGCATCCCTTGCGGGGGCCAT
TTGCTTGATCCTGTGCCCAAAGAGCTCTTCCCCGAGACGCCAGTGATGTACGCACGAGCGGTGCCGATCGAGGACCACTGGGACGCGACTGGCGTCGGCT
ATTTCCGAAGGAAGCCCGACATCTTTGACTGCCCCGTGTACCAAACCACGCAGCGAGGACCGACGTACGTCTTCTTGGCGACGCTCCACACCGCTGTACC
CAAGAGCAAATGGACACTTGCCGGCGTCGCGCTGGTGCTACAGAAAGACGCCTAATTGGTCTGCATGCTGATTAATCCGCCAACGTCCGTTTCCGAGAAA
TCCGGCAGTCAAGCAGATTTATCAGACTTACCTGGCTGTGGAACTAGATTTCCCTGTCTGCGCCGGTGGGTCACCACCCACTGGGCGGAGCTATGAACAT
GAGAGAATCGTGCAGGAGGCGGAGGCGAGATTGCCGTTCCCAGCCCTCCAAGTTAGGAGCCACCCACCGTCGGTCTCGATCACAGGATTTCGGATATAAA
CTCGCCACCGTGGGTCTCCCATCGCACTCGAGTGCTCCCAACCTGGCAGGTTCCCTGCTGTCTCTTATCAGCTCAAATGAATACTACTAGGCATGGAGCC
GGATGGCGAAAATGTCCACCAGTCTGGCGATCGCGCGTCAAAGAAAAGTGGCCGTTCAGAATACAGTATTCGAGTCGGAGACCCCGCCATCCCACCGCAA
GGAGCGAGGACTGATCGCGATGATCAGATCCATCTTGGTCACCGCTTCGCCCGGACCACATTGGTGGGTGGCAGTTCACCTCCGAGTTGATGTGCCGTGT
CACGGTAGTCGTCTATTTTCGTAAATATAGTATATTAGGTTGTCTATATCTGTCATTTACGGATTTGTTCCGGCTCTTTTGGACTCACGAGGATCTACAG
CCAGTTTCCGAGACAGAGACTGCGAGAAGCTCCGTTAGCCAACAGACAATGCCTCTCCCCTCCGGATCGACAGCGCCGTTTCCACTGCATAGAGTCGAGT
GAGAGGCGCAGAGGCGGAGAGCGGCACCCACATGGCGCAGCTGGCACCCATTGAAGTGGATGTGGCAGCTCAGCAAGTCCCACGCCGCAGAGGCAGGGCA
AAGGGACCCCACCACGATGGAGATCGGCCAGTCTCTGCATACAAAAGCCCCGAAACGCTAATGAGCGGCCAGGACCACTTTGCAAGAACCGCGCGGTGTT
TCACACACCATTGCTTGGAACCGGCGCATATTCACCAGCCGCCGCTCCCGCTCCGTATTACTCGGCGCCGATGTCTGCCATCAGTCGATCGATCGATCAG
CTCGTCATGCCATCCGACGACGACAAGACTGCTCAGTCCGCAACCTTCCCGCTCGCGCATCCGCACGACCACTTTCCAAAACCACAGCTCACCACCATGA
CCATTGCCCGCACCAACAGCATCGGCTTTACCGCCATTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCGCTCGGGCGCCAGACTA
GCATCGACTCGAACCCGATGATGCGCGTGACGCTGCCCAAGGAGTTTGGCGACGATCCGCTCTCGAGCCCCCTCGGCGACCTGCCCATGCCGGCCTTTTT
CAACGCTACCGAGACTGAGGAAGTGAAGCAGCCCGAGCCGGAGCCGGAGGTCGAACAGACGCACAAGTCGTCGGGCTTTGCCAACGTCTTCACGCGCCGC
CGCCAGTCGTCGATTGAAAAGAAGCCGCCCATGGCGCCGACGCCGACGCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGTTCCCCGAGGACGAAGAAGAAGAGGAGGATGAGGA
CCGCAACCAGCAGCGCGAGTCGCTGCTCATGCTCATGCGCGTGCCCGAGATCGAGCGCGTCTCGCTCGTGCCGCTCATGATGGCTAGCGACATGGACTAC
TAAACAAACGACCCCAAGTACCCTCTCTCTCGATGTTGTTCCATGTCCGTCGACGTCCTCTGGCTGTTGTGCCGTGCCTCGCCANNNNNNNNNNNNNNNN
NNNCTGTAAGATATGAAGAGACGAAAACAAGACGCAAGACAAAGCGACCGAAGCTTTGCTCGAGCTGTCTCCACCCATTCTACAAATGCCGTACTAGTAC
TGTAACTCCCC