Description :
From Genome Similarity Track
Location :
Scaffold_150:1957- 3757
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014995Protein of unknown function

Sequence
1800 bases(100 bases per row)
ATCTTGACGGGGCGGTGCGTCACTATCGTTTGCTCGTTGCGGCCAAAAGCATTCAGAATCCTGCACCATCACACACAAACTCACAGTATATATGAAGGTA
ATACGCAGTACACATTCAAACCTTTCGTTCGTTTGCATCTTGTGTCACACCTATCAACCACAGCACGAAAGACAATATGCCGCTGGTGGTGGGAACCGAA
CCCACACAAGCCATGTGCCTTGGCTTGCTCCAGTGCAAGCGCGCCAGCACAGTGTGCTGCAGTCAATAACAGGAGAGGTGCGGGCTGGGTCGACTTGTGT
AGTTGAGCGAAAAAAATGCAGCCTGGCACACGAGAGCTGGTGTCAGCCAGGTGTGCAGTAGATGGGTGATGAGAAGCACCTGTCCACGTAATTGCTGGCG
CGCGTGTTTTTACACTGGCTGAATTTTGTGTTGGCGTTGTGCTTGGTAATTACCTGTTGGTAAATACCTCTAATTGTTGTGTCCTTTCCTGCTCTGAATA
ATGGACTGCTCACGCCACAACACATCCTCATTTCAAAATTTACCACGTACAGCGTACATCGCTTCCGTGACTTCCTTTGCCTTTTTCTCGTCAAAACTGT
TTGCATGTTTTTCTCGCTGACCGGAGCGTTTCAGACGCTGATACATTGCCTATGGACTCGTCGCTTTTGCTCAATCACAACTGCTTCTGCGTCATTTAAA
CTCCTAATCTCCAATATCATTGTGTTGTCGAGCCGTCATTAACCCTAGCCCGTTTACTCAAGGCCCACTATTTGTGTGTTGTGTGTGTTTTACACGATTC
AGAATGGTCGAAATGATCGGAACGGTGACGGTATGGAATATAGTAGGGGGCTTCGAACATGAAACATAAAAGATTACACGCATAAACGCCTAGCAAAAAA
TCACGCGACCTAATTAAATGTTTCTTTTCTTACACTAAATGTAATGGGACTCCCCATTACATGGGTTCTCGGGTCAGGTGAGCGCGGGTTGTCATCCACA
TGGGTTCTATCGCCTCTTCCAAACCCACCCACTACGTACAGTTCAGGACACATTAATATGTGTCATGCATGAACACTGTACGTAGTCAATTGCATGTTAA
CCAATAGGGCTAAGCCGTTAAGATTTAATACCATTGGATGATAGTCGGACTGGACACCCGACTATCTACTAATGAGAGATACCGCAGGTTTCAGTCAGAA
CGATTGCATGTTAGCATTTTAAAATTCTAACTCACTTCTCGTTTTGCACGCTACTGCGCAAAGCTCCAACCTTCCTCTTGGACACAGCGTTATCGTTGTG
CCCTTTTGTAATGGGCTAAGGCTGCCATTACATGCAAGGTGGCTCTTTGTGTGTGTCACACACCACCTTGTGGAAGTGCATTGTGGGTGCGAAGATATTG
GGTGAAACACATAAAAGTGATCCCACATGCACAGGTGACGTCATCGTCTGATGTCAGAGCAATCTGTGTCTGAGTTGAGTGTTGATCGCTCGCAATCATT
GAGATTCGGCGTGATTACGCACGACAGTACTCTAGACATGTGAATGATGGTTCCTACTTTGGAAAACCACACTGGTGACGAGGCCAACGTGTCTCTACCA
TCTGAAGTGAGTGGCTTCCGCCAATCACTTTGCAGGGAATCTCCGCGGTACTTCAAGTTCAAGTTCCCAGCAGATCCCCTGGGTTCAACCTCAGTGTACC
CAAAGTTTTATATATCAGATTCATATGTTTTATTTCTGCATGTGTAGGTTTAGTTGTAAAACCTGTAGGAGCCCTAGTGGTGTTTCATATGTAGTGTCAG