Description :
From Genome Similarity Track
Location :
Scaffold_141:19564- 21873
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_141-snap-gene-0.21Conserved gene of unknown function

Sequence
2309 bases(100 bases per row)
GAGCCTGGAGGTACTGATTGCTTCCGCGCTTGATCAGCTCTTGCAGGAGCACGCGCGAATAGTACGGAGTCGCCGCTGGCTCCTGCGTCAGCTGCTTCTG
GAGTCCGTCGACCCAAAAGTTCACAGCGATCGTGTACGCGTCCGAGTCGACTTGATGCCACCAGCCCTCGGGGATGAACAGCGCGTCTGTTATCAACAGA
GAAACGAGTCAGCACCAGATCTACCTCATGTCGAATAGTCCTCAGATAGATAAAGAGACAATCTATACCTACCTCCAGCGTCGACCACAAATCTCTGGGG
CTTCGCATCTGCAAATCTCGGATACGCAGCGAAATCTGGACTACTGACGTCCACTTGGCTGTGGTTCGCCGACTTTGTGTGTACTGGGTACGCGTAGAGC
TTGCCGCTCTCCGAGGGCGGATACAACAACACGGTCTTGCGGCCATGCAGCACCACGAGGATGTTGCGGTACGCATCGTAGTGGAGGCTCGTGCGACTTG
AGTGTACCGTCATCCACAAGTTCACTTGGCTCAGTGACTGGGAGCTGGTCGATGAGAGGCACTCTGGGCTGCACTTGGAAAGCATGACGAGTAGGAGTCG
AGCGTGAGGTAGGATTCAATACAAAGTTCGGTGATTGCTGCCAGGTAGTGCTTACATGATGAAATCGTCCATGATCTTGGGCAAAATGGCTTTGGAGCAC
GTCGCGTCGGGTCGGTAGACTACGATTGGGCACTGGCACAGATAAAACTCGAGGTCGTCGATGTCCTGCAGCCAGTGTGCTCTTTTCGCGTGCGTCGCCT
GGTAAAAGTCCACAAAGTCGCCAAACTTGAGCTCCACGCTCTGCCGCGCGCGCTCTTCACCCGAGTAGCAGCCGCTGCGAGTGTCTTTGCACGCGATGTC
GACCACTGAATGACGTAATGCGCATTGGGGCAACCAATAGACACACAACTCGAGAACTAATGTCAGCACTATTGGTCAATGAACCCTATTGGAGCTCTTC
AAAAAGGAAGGCGGGACGAGCATCACTTCCACATTTGTACCTGTGAGACGGTGGTGCGCAAAAGACTCGAGCGAGTGGATGGCGCTGGGCGTGTAGAGCA
GCAGGCGGTCGCTGCGCACGCATTGCGACGCGAAGCCTGCGAGGAACGCTGGTGTGTGCGCAGCCAAATCCATGTTGGCTCGTATCTTCGTTTGTCAAAT
TCTGTGAAATTTTGGATTTCACAGAATTTGTCCAATCAGATGCATTAAAGAATGAAATTTCATCCAATCATGTTGGCCTAAAAGATTTGTCCGTTCGAAG
ATGATGCTGAGTTTGTATTCGCGCACACGTCAAGCTGGACGCCTCTATCACACTTCTTGCTACTGCAGTATGCTCAGGCTATTACAGCGCGAAGACTCCT
CAGTTTCATGACTCTACTCTATGCCTCCACGTCCTCACCAATAGCAACAGATCCACCGCCGCTATCAGTCTTCGAGTGGCGAACGCAGAAGCCGTGGCGC
TGAGCCCACTTTTGGCATCCACTCTCAGCGCATCGCGAGCCGCCGCCGTGCGCTCGGCAATGCCCTTTCGAGATCGCGCCTTTCTCGCAGCCGGGTGTCT
GGCAGCGCACGCCTCCACCGTGGGTCTTGCAGCAGCCGCGTGATTGGACGGCACGCGAACAGCCCTCCACGCTGCAGTACTTGATGCCACCGTGCGCGCT
GCACTTGTGGCCGAACTGCGCCACCCGCGTGCAGCCAGTGTGCGAGCAAAGTCGCCGACCGCCGTGGCCTGAGCAAGCGTTGTTGAAACGCGCGAATTTG
GTGCATCCGGGCACCTCGCAGCGTCGTCGTCGGTACCGTTTTGCATCCGAGTCGTCTCCGTGTCGTGCCTCTTCTTCTTCTTCTTCTACGTGTTGATTTT
CTATATCTTCTTCGTTGTGGCTGCGCGTCCCCTCGTCCTGTGTATTGATCGTAGAATCGTTGCTGTTTCCTTCTGGGATGGTGTCGCCTTGGTGCTCTTG
CGTATCGTCTTTCGCGGCGCTCTTCGTGGTGTCTTCTGGGGCTATGGCGCCAATTGTTGCGGTTGCAACGAGGTTGTTTTCAGTGTCGGATCCGTTCATT
GGCGTGTTCTCAGCCATCGCTGCGGTGTCGGCTGTGCTTAATACTGGCCCTGCTGCTGCTCCTGCTGCTACTGTTGGAGCTTCCAGTTGGTCTGCTGCAG
GATCGGAATTGGCGCCGTCACCACCGCTCGGCTGTTGCTGCTGCTTGTCCTTTGCGATCACGGCAGCCATGAGAAGCGTGTCAATCCACTCTCTCACAGG
CTGGCCATC