Description :
From Genome Similarity Track
Location :
scaffold_471:19562- 24547
Transcript NameFunction/comments
g8634.t1 conserved hypothetical protein
g8635.t1 conserved hypothetical protein
g8636.t1 E3 ubiquitin ligase , putative
g8637.t1 conserved hypothetical protein

Sequence
4985 bases(100 bases per row)
TTTGACAGCTTGTGGGGCAGGACAGCTATCTCACCTCACGTGGGGCATGAACGCGTCGTTCCTCTCAACGGCGTAGATCTACAGCGGAAAGCAAGAGCAG
CACGGATTGTTTTCAGTGGCAAGGTCTTGTCTCACGTGTCAAATGCCGCTAAAAGATCATCCCACCTCTTTGGAGCGGTCGTGCGCTTGCTGGAGCTCGG
GCGTAAGCTTCAGCAGCCCGAAGACGCACTGGAAGTACAGCTCCTGTGAGCATTTTGGGACGAATTGGTTATTTTCCCACAGTACTGCAAAGTCGTATTG
AGTAAATTCTATTCACTGCACCTTGAACGCCACAGTCTCGATCTCCACGTCCAGAGCAGGCATCGAATCCGCCAATTCCGACAGCTTAGCCACCACCTCT
GCAGTCGTCAGTCCCTTCACATTCAAGAGAATTAGCGCAATGAAAAAGCTGTTTTAGAGAAATATTAGAGAAGTATAGTGTCACTTCGACCTACCTTCAC
GCCGGAGAGCACTGTCATATGCGGCAGGAAGGACGGCGTCGCTAGTCTCTCCGCGTACGCGTTGATAATTTCTTCGAGCTCCTTGGCTGCCGGTTGTGCA
GGGACAGCCCATATAGAGAAGCCGGCGACGAGGTCAGCAGCGCTCGTGTCCTCCACCATGTTTCTCCAAATTGTATCGACACTTTGCACTTCAAATTGTG
ACACAAATCAGAGATGGGTAGTTGTAATTGGCTGAAAAGAAGGGATATTCAAGATGAGGCCTCTATTTGGGTCTTCACAGTAGCGAGCTGCTTGGTGAAG
GCGGCCTCGCCAGCGCCTAGGGCGTTCTCCTCGGCCGAAGCCAGCTCCGGCATCTCCTTCAAGCAAGCCAGAATGGCTGTTGCAGAAGTCTCTAATTCGC
TCACAGCCTCAGACAACTCGTCAGTTCCGATGGGAGGGTACAACGCCGCGCCGAAGTCCACGATCGCGTCCTGCGCTGCCGTGTAGCTGATGTCCAGCTG
GGCTGTCCACTTCAAGAACGCGTCTTGGTCGTTCGTGATCGTCAACTTCTTGATGGTCAACACACCGCGTTTCATTATTGCAGCGCACATCGACAGCAGC
TTCAATCCGCTCTGGAACAGCGTACGCTCCTCCTCCGTCAAGTTGGAGTCGAAGCCGAACTCGTCGTCCTGCTCCACCTCGTCCAGTGCTGCACCTTGAC
TGTCACCTTCCTCCTGCTCAGAGAGGAACTCATTCAGCTCGTCGATTGTCGAATTCAGCATCGTAATACACTGTAGCATATCAGGAAATCATCAGCAAAG
TTGTAGATACAGCAAATAGCCCTAAGCGTTCGTACCTGCAGCATGCTGCGCTTTGATGCCACGCAGTTGGACTTCGACACGCGCGAAGTAGAATACTCCC
ATACACGACCAGTTAGTTGTGGAACCTTGGCCAAATCACCCTTTTCGAAGGTTTTTGCCAGGTCGTGCACGCTTTTGATCAGACGGCTACAACGCATAAG
CATCAAACCAGTGTCAGTTCCGAAACCAGCTTACTACGCTATTGAAATTGATAATGTACATTGCATCACTGATAATTTCCGTCGCGAGTGACGGACCGGC
ACCGCAGAATAGCGCAACGTTGGTGGCGGCCAGAAGTTGCTCGCAGGGCTTGTCCAGCGCCTCACAGATGCTGGCTCCTTCCTCCTTGCTGGGCGTCTTG
CTATACACAAGCGAAAACTTGGTCACCGTGTGTCCGATGACTCCAGTTGCCTACGATAACCAATAACGATCAGCACGTGGAGCAATGTATTAGAAACCTA
TAGAGCTCTCGCGACGACCTACCGCAACGAAAACCTCCCGCGCGACGTCAAAGTCCGTATGTTGCAGCCAGAATGTGGGCCGGAAGCTGTGCTGCTTCTG
GTTCCTGTCCTGCAGCTCCTCCAACTGCTCCAGGTACTTCACCAGTTGCGCGTCAAAGGCCGTCAAGAAGCTCGTCATGTTTCTAGCTTCGATGAATTTG
GTCTCTTCCAGCCAAGCACAAAGTGGTACAATCATTCCGTCTCGAATGGTGTCCACCACATAGCTTGTCAAAAACCGGTAATACTTGCAGCAATTTACGC
GGGAACCAGAGCTGCAGTCCACATTGCGCTGCCTCAGTAACCCAAGGGCAGCCTCGGGTCTTCATTCGTCTTCCCCCTTATAAGATTTTCTTACATAACC
TTTATTTGCAAGGTGACGCTACTACTAAAAGGGTTAAAGTCATGCAGATGATGGGCCTTGAAGCCGAAGACATGCAGGACGAATGGGAATGGCCGGAGGA
CTGCAAGCCGCAGCGGGAGATGGAGAACCACCTGCGCTGTCAGATCTGCGGCGACTTCTTCCACGGCCCAGTGTTGTTGCCCTGCTCGCACACATTCTGC
TCGACCTGTGTGCGCCGCTTCCTGCAGAGCAAAGGGGCGCACGGCTGCTGTCCGTCGTGCAAAAAGCCCTGCACGTCGAGGGAATTGGTGCCGAACCGGG
CGCTGGAGCAGGTAGCTCTGCTCTTTGAGCAGTCTAAACCAGATCTGCTCAAGAGACTGAAGGGAACCAAAGCACCCAGCTCTGCTACGTCTACTCCAAA
CACGGAGAAAAAGAAGACCAAACAGGACAAACCAGAACGCATGCCGCTCATGTCGTACAACGTCATGAGGGACAAGGAAGTAAGGAAACTGCTGGACTCC
ATCAACGTTCGAGTGCCGACCAAGAATCGAGACGAGATCATTCAGATTCACAAAGAGGTTCTCTGTCCTGAATTGATGTGTACAGGTAGACCTTTTACTC
ATTTGAGACTTCTTTTTTCTGTAGTACGTGTTGCTGTCGAACGCTCAAGCCGATTCAGTCAATCCAAAGAGTGCAACTCAACTGCGAGAGGAAGTCGTGC
GAAATCACTATGCAAGAATTCAACTGAAGGCCAAGACGGACGCGTTCAAACGAAGCCACAGTGGAAGTGAAAACGCAGGGAGCGGGAACGCGGCGTCCCC
GTCGTCGGGTGTGTCCGTGCAGATGCGCGTCAATTTTGAGAAGCTCAGACAAGATATTGCAGACCGGAAAGCAGGAAAGAAACCGCCAACACCAGCGACG
GATACATCATCAGCCAGCACCCCGGCAAAACAGAAGAAGACAACGGATGAAGACGCAACATCCGTGGGCGTGTGGAGACATTTTTGTGCTCTGGACACAA
GCATCAACCAAGAATTCTACGTGAACTCGGTGACTCATGAAATTCGAACTGTGTTGCCGTCACCACTTGTTCAAGAGCAGTCGCCCGCGAATCGCTATGA
TGATCTGGATGGTGTGGCACGTGCTTTATCCGAGAAAGAATCTGGCAAGGCGAAGACTCCGGTTAAAGGAAAGGCAAAGGCCAAGCGGGCAATTGCACCT
GCATTTGCTTCTCCAGACGCTACGTCTGAATTCCAACGAGCTACCGAAGAGATTGTCGTCTCCGAAAATGAAGGTGAGGACGGAGAGGAGGAACATGCAA
GTGGAAGTAAAAAGCGGGAAAGTCTTGGCAAGCACGCTCGGAGCAACGATAAGTCCGACTCGGCAGCTGATGACTCGGGTAAAGCGACTGCCAGCGCAGA
AGACGCGAGTGAGACGCCCAGCGAATGGCAATGCTCACGGTGTACATTAATCAACGAAGCGATGTGTCGGCAATGCGAAGCATGCGGCTACGAGGCATCA
TCCACCCCTGCCAAGAAGCGCCTGCGCAAGAAGATGCATTTCCAAAGCAAAATATCTTTGTAATAGACTCCATTGATTCTCTCCCGTTCCTGTCTTTCGT
TCTATGAGAGCAGCGCCTTGAACTCCTCGTATTCAATTTCTCCGCTTCCATCCGTGTCCAGCTCGTCGAGCATGCGATCGATGTCGATGGGCAAACCGAA
GTCTTTCTTGATGAGCTGTACTAGCATTTTCCGCTCCACATGCCCTGTCTTGTCGGGGTTACCTCCGCAAGCCACGAAGGCGTCGATGAAGTCAGACTCG
TCGTCAAACTGCGCTGCTCGAAGCTTCTGTGCCTCGATCACTTGGAGAAACTCGGCAAACTCGATCTCTCCGCTGTGGTCATTATCAACCTCAGCGATCA
TTTGAAAGAGCTCTTCGTCGGTCGGCTTTTGGCCCATGGCTTCCAGTACCTTCGACAGTTCGTACTTGTCGATAGTGCCACTGCCGTCTTTGTCAAAGTG
AACGAATGACTCGCGGCAGGCGTCGATTTCTTCCTGCGTCAGGATCATACCAGCAAATTTAGTCTGTGCACACCCACGATAACTATGTGCGACGCTTCAT
TCCTACAAAACCAAAACAAAAGTTTAAAAAAGCTCATAGTAAACGTGTTGAAAACAGCAACATCAAGGACAATGTTGCGCAATACATCACTCTCCCGTTG
CAGCTTCCTGTGTCTGAATCGTCGATACTAAATCGTTGTCTTTCGTTATGGCCAATTCCTTGCGCCTTGTGATGAAAATTATATGTGCACTCCTCAGATT
TTGATCAGGAGGATTTCACGCACATACAACGTCTGTCAAAAAAACACATATCCATCATAAGTCAGCTTCACCTTCAACATACTTGTACAGATAAATGACA
ATAGCCTTACCCAAAGGCGTTCACGCTTCTCCTGCGTCGGCAACAGACGCACCAGCTTAGGCACGAGCTCCTGCATCTGCGGGTGTGAGCAAATCGACAG
TAGGTAGCTGAAGAAAGCGTCGAGCGACATGGCGTCCTGGCCAAAGAGCCGGCAGTTGTCCTTAAACACCTGCAAATTCGCGTACGGGCACTTGGTCTGC
ACAAAGTTCATCACGTCCGAGTACACTTCCTTCATCTCCGCACCCTTAACCGAAGACGGAAGCGGAGGCACTGGCTGCTGAGTAGCCTTTGGCGCCGAAG
GCTGGACAAACGAATTATACATGGCTTGTGCCTGTGGGGGCGCTGTGTACGACGCGTTGGGCGTTGGAGCTGGGTATGACTTGTA