Description :
From Genome Similarity Track
Location :
Scaffold_154:19562- 23485
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_154-snap-gene-0.14Multicopper oxidase, type 3
Pytiw_DAOMBR242034maker-piw_contig_154-snap-gene-0.18DNA mismatch repair protein Msh3

Sequence
3923 bases(100 bases per row)
CCCGACTCGCGCTGCTCAACTCGCTTGTGACAGAGCTCGACGCGTTCAAAGAGCCTATCGAGCGTATCTCGGTCAACGGTGAGCTCAACACGACGCTCCA
TGTGGCCCCACTGCACTTTGAAGACGGACCGATCTCGTTCTGGACGCGCGCGTACGAAGGCAGCGTCCCGGGACCGACGCTGCGCGTGAAACCGGGCGAC
GTGATCAATATCGAGCTCGTGAACGACCTCGCGCCCAACGTGCCCGGGCCGTGGACCATGAACACGAACCACAACCCGAACACGACCAACTTGCACGTGC
ACGGCATGCACGTGGACCCGACGGGCCTCGCAGACAACATCTTCCGCGTCGTGTCGCCCGGCGAAAGCGCGCTGACGCAGATCCACGTGCCCAGAAACCA
CCCGCGCGGGCTTTTCCACTACCACCCGCACTACCACGGCTCGGTCTTTGCGCAGATGGGCGGCGGCATGGCCGGCGCGCTCGTCGTGGACCACAATGGC
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGGAGGAGAT
CCCAGAAGAGTACCGAGATCTGAAGCAGCACGTGCTGGTCCTGCAGGAGTTCCGCTTCTCCGGCGGGCTCGGGAGCTCGGCGATCGCGGTAGCCAAGGCC
TCGCGCAGTCGGCTGGATCTCAAGCTCAAGTATACGATAAAGGCCGCTCTCGATGACGTCATGCGCGAGCTGTACCCGGGTGTGCACCAAGTGCAGCCGT
CCATCGACATTCCCATGGCCGAGGGGCTCCAGAGTCGGTACCCTGCCGGCTCGAGCGGCCCACCAGTGACCGACTACTTCACTGTGAACGGTCAGTACAT
CCCCAAGATCGAGCTCCAGCCGCGCGAGAACCGAGTCCTGCGGCTCGTGAACGCCGGTGGCGTCTGTGCGCTGCAGCTCTCCGTGCCCGGGTGCTCCATG
ACGCTCGCAGCGACCGATGGGATCTACTTGACCGAGCCCCGCGCGATCACGACGCTGCTGCTGACCACAGGCAGTCGCGCTGACGTGGTCGTGAACTGCG
AGCCCAACAGCGCGACGCTCGAGCCTCTGCGACCAGTGCAGTCCGTGCGCGACCTATCGTTCGACGGCTTCCTCGGAAAGACCTCGGACGTGTACGCCGG
CGTTGTTGCGATGGTCCACGTCAAGGGCGCGTCGATGGAAATGAAGCCGGTCACGAAAATCCCAGCGCCGTCGTCTCTCTACGGCAAGCAGGCGAGTCTG
CTGCAGCTGAGCGCCCTGGACCGCGAGCTCATGGACCACGAGCCGTTCGCGTTCGAGTTCTCCATGGGCGGCAAGGTCCAGAAGGACGGCTTCACGTACA
AGAACTACTTCATCAACGGCAAGGAGTTTGACGGCGAGAGCATCCGCGACATGCCCCTGGGCATCGTGCAGGAGTGGGTCGTGGTCAACAGACACCTCGT
GGACAGCTCGGTCACGACGGCCAACCACCCGTTCCACCTGCACACGAATGCGTTCCAGATCATCGCCATGAGCCACGGCGAGGGTGCCGAGTACAAAGTT
GGCGACTGGCGCGACGTCATCTCCGTGCCAACCCCCGGGAACGTCACGATCCGCTTCCGCCCCGTGGACTTTGTTGGCAAGATCGTCGCGCACTGCCACG
TGCTAGGCCACTCGGACGGCGGCATGATTGCCGCGGTCGCCATCACGCACTAGCGTGAGTGTTTACGGTGTGTTTGTTTTCGTGTTCTGCTCGGCTCGGC
GCACGATGTGGTCTGGGATCCCGGCGAGCCGCGCGGCATAAAGCGCAAAGCTCTCGCTGGCGACGCCGTCTGTAATTATATAATGAAAGGTCATCCTCTT
GCGCTGGTCTTGGGTCTTCGATTGCAAAGCTGCTGGTGCTTCTGAGCCATCGCTGAGCGTGAACTTGAACTGCTTCGTCTGGCATCGCAAGCCCAACCTC
TTTTGAAGCCGCTTGACCACTGGCGTCATGTGCGTGGCAAACACCACGTGACACCCGACATTTTCAGCAAAGTACGTCATGAGCCCGAAGGCCAACGCGC
TTGCATGGTACGCAGTCATCCCGTAGCCGAGTTCGTCGATCAGCACGAACGATTTCGCGGTCACAGCTTGCGAAATCTTGCTCAGCGCGACCATTTCGTC
GTCACGCTGCTGTGTGGAATTTGGTTTGTTGTTTAGCTGGAAACTCGTGCTCGAAGAGCGATGCATTCTCGTGAACACGCCGTCGAAAATGGTCAACTGC
ACCTTGTCTGCAGGCACGAAGGACCCGATCTGCGCCAGGATGACGATGAGCGCACACGTGCGCAGCAGACTGCTCTTGCCGCCCATATTGGGGCCAGAGA
CTACCAGCAGGGGTCCCTTGGATGGCTCGCCACCACCACTTTGCATCGCGACCGAGTTACTCATGTACGACGAGGCCTTGATGAGCGAGGCCTCGAGAAT
CGCATTGCGTCCACCGATGATTTCGAGAAGCTGCCTGTGTTGCCTGGATGCCACGAAGCGTGGCAGCGTGTAGCCTGGCCGAGTCCTCGCGAGTGTTGCT
AGCGAGCAGAGTGCATCGATATACGCCAGTTTGTCCACGCAATCGGTCGCCATCACGTAAATCTGCGCGTCAACATGGGCGACAAATGCTCGCCACGCAG
ACTCGACAAGTTGGTTCTTCATCTGCAGCAGGAAGTCCTCTCGCATTTGCAGCTGGTGGATATCTCGTGGATGGAAGCGCACGAGCGTCTTGGTCGAGTT
CACGACACGCCAGTCAGAGGGCACCAGGTGGAGCTTCTCCCGCTTGACAATGACCAAATGGTGGGCTTCTTTCGCAATGCCGTAGCGGAACGATGCGAAC
TCGAGCGATGCGTCTTGGAGAACCGAGCGACACTGTTGAAGCACACCGTCGAATTCAGCAGTGAGCGCTTGCAGATCTCTACAGAGTTCTTGATATCGGG
CCTCAAGATCTGCACCCAAGCTAAGTCGCTTCAAAATCGCCTGCTCAGTGTCGTTGGCAATTGCTGAGTCTCGACAGATCTCTTCCAGACAACTGCGCAC
TTGGACACTCAGTCTCGGATAACTTTTCAGTAGCCGCAAGAGCAGTTTGGGCTTTTGCTCACTCCCTGGCGAACCAAGCTGCAACGTTTCTAGCTGTGCA
ACACTGCACACTTCGCAAATGCTCTCCACACATTCCTCGACATCGAGGAAGCTCTCGAGGCCTTTCACCAGCTGCGCGGGGGAAATCTTCCATGTGTGGA
TTTGGTTCACGCACCGCAGCAGCGGCTTTGACTTTGGCAGCAAAGTTCCTACGATCTCTTCGTAGACGAGTTGATACATCGTCGAAGTAGATGCTGGCGA
CTCGCTGGGACCTCCAACCAGGTGTCGAACAGTGCTTTGCCGCTCTTCGATCTCCGACATGATCGTGGATGGCGAACTGATCCATGCTCGCAGCCTTCGA
GCTCCTGACTCTGTTTTAGTATGATTCAAGATGGAGAATAGCGAGCCTGTCACCTTTCCAGTAGTCTATAAGGCAGCAAAAAGCAATTAAGTCGTCGATT
TCAAAATGAACACGCCAACAGACAAGAACAGTCAATAATGCTTACCGAACTGCGGAAAATGTCGAGGTCCCGTAGACTATCGCTTGGTAATCCGAACACC
TGTGCGGATTTCGTTCCAGCAGTCTGAATGGAGCAATATTTGTCAGACATCAGCGATTTCTCCAGATCGAAGGTCGTCAGGTAGTGCCACATGCCTCCAA
AGCAGCAAGTGCTGAGCATCGGG