Description :
From Genome Similarity Track
Location :
Scaffold_721:1956- 6432
Transcript NameFunction/comments
Hyaar_Emoy2814468hypothetical protein

Sequence
4476 bases(100 bases per row)
ATTACGTGTACCCACTACATGTAATCCCCGAGTCCATAGTTCCGGATCGGAGTCCACAATTTATTTCAGGGTTTTGGCGCCATGTGTTTGAGCTGCTTGG
TAGCAGCTCCACATGTCTACCGGCGATCATCCCCAAACCGATGGTCATACCGAAAGGGCCAACCGTGTTGTGACGGATGTATTGCGCACAATCGCAACTC
TCAACGAATGGAGCGTACATTTGCCATTCGTGAAGTTTGCTATTGAAAACAGTGTTCACGCTATTACGGGTGAAACACCGTTCTATGTTAACGGACTGCT
CCATCCTCGGACGCCAGTCTCGTTTGTGCGCAGCCCGAGGCTTAGTGGGGGAGGGCCCCTTACCACGCTCATAGCAAATGCGGAAGAGCGTACTGGGCTC
ACCAATGTTATGGCAGAAACTCGCTCTAGTGACCCTGCCAGTATCACAGTGGTCATGACACAAGAGAGTGCCAAGTCGGAGTCACGACGTTGTCAGTGCT
CCAAAGCAATGACGATAGGTCATCATTAGCAGCAACGAACGATGACCGACCTCTTGGTGGTGTCATTGGCGAGTTGGATGAAAAGAGCTCAACGCTTTTT
CAAGAGCGATTAGCCATCACACGTAAGGTCCGTGAAGTTATGGCAAGCGCACAGTACAAGCGAGACCAATATGCAGACTAAATTGGTCACAGAAATCATG
GACACTTTATTGTAGGAGAAAAAGTAATTTTAAGTACTAACACTCTACCTAAAGATGCATTTTCAGTACTACCTGGTGGTACTAACAAACTATTGTCACG
ATTTATCGGGCCTTTTACTATGGTAGAGGAAGTCGGAGACCTAAATTATAGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATGAACTGTCGAAGACGCGACCG
CTGTACTAGCAGGAGGCGTCAAGACACTAGCATTCTGTGTCGTATTCGTTTCATCACGATGCACACGCTTAGTGGTCGAAGATGTGAGCGTCTTCTCAGG
CAACTCACCGTCCTTCCCACGTTTAGATGGCATTCAAAAGCCGTGCGGTGTCGCTCAGATAAAGACCGCACTCACAGGAAGTTCAGACAAGCAAGCACAG
ATGACGAGCAGCACGTCTTTGACGGCTCACTCTCAAGTGCATCTCCTTCGTCGCGTTTTTCACAGAATGTTAACAATCGTTTTGAAACGGGGGTGGTTTA
ACGGGGTCGAACCGTTGCACGAGACTTTCCGTGTAAAGGCACGGAAAAGTCTGAGAAAGGTTCTAGGTGCGGTACGCACTTAGACCTTTCATGTGGTTGG
GGTACAGCAATTGCGTACCTACCACAAGTGTGTGTCACACACGGATGACGTCACTACTTGACGTCATTACATGATGTCATTGAAGTACGTCATCAGCGCG
CTTATATACAGTTTAAGCGCGCTGTAGAGACGGCGTCTCATCAGAGCGTGCGTCTAGTCTTTTGTCTTTTAGCCAATAACAATTTAGATTTCTGTTTAAT
TCATTAAATAGAAATCATTCTTTAATTTGCGATCTTTGTAACGAGTGGACCGGAGGACGGGAAACCGCGTCCGAGCCACACCGAACAATAAGCGTTCATC
TATCGGTGAGGCATTCGTAAGACGCCCAACTGAACCTCGCTGCACGCGAGAGAAGACGGTAAAACCGCTTTCTCGCAGGTGCCTAAATGTGTGTGTTAAG
GTAGTGCGTGGAAGCTTTAAGCGCTCGCCTACAAGAAGAACTTGGTAGCACTAGTCCTTCCCACGACCCGTCTCTCTGTGAGCGTTTCAGTGAGGATGAG
TTTCAATGTTGATTGCACTCAATTCCCCACCTCTTCCAATATCAGAGGGAGGTGGCTGAACATATGGCTCAGGGACTTGATGACCAAGCCCTTGCTAATT
TGTCGAGTTGCTCACCAGAGCAACGTGTTCCTCAACTGGAACAGTTTAAGAAGTTCGTGCTCGGACAGCGGATGTCCGCGTCCGAGGCACAAAGTCATGA
AGTGGCGGAGTCCATCAGTAAGACTCATGATGAGCTTCTGCGCGAGCAGGCTCGGAACGAGGCGCTCAACAGAACTGTTGAGTCGCTCTCGGCCCGGTCT
ATTAAGCCGAGGCCTATTAGGATGGACCCTCCTAAATTTGATGGCACTGCCGTCCGCACTATTGTACACTGGCTTCTAGCCGTTGAGCAATGTGGTGTGG
CGCAGCTTATCGAGGACGATACCAGAATGGTATCGTACGCTATATCCCATTTGCGGGGTAAGTCCTCGAAATGGGCTTACTCAGCGCTTATGGCCAACAG
TAAAGCGTTTTACACCGATCGGAAACGGAGTTGGTGCTTTGTGTTGGTGCTCTTCATGAAGTCGAAGGAAGCTGTTATTGTGAGCTCTGACGACAAATCT
ACCGTTAAGAGCGTCCTGTGTAGGAATACTGGAGTTGTTGCGAACGGATGCATCTACGATGCGTCTAAGCGAAATCCGCTCTTCTCATGGGCGATCTTTA
AGACAAAGATTCGCGCCATATATCAGCCGCCGAACAACGAAGTGTTACTTCGAGCGCGCTTCTTTAGCAAGCGCAGCGATCCTTGCAAGACTATGTACAG
GAGGTGTGCTCTCTGTCGGCGTCTGTTAGTGTGGTCCGATACCGGAAAACATTAAGGTGCCCACGTCCCTAAACGGACTGCGACGTGGCCCAGCGCGACA
TGCCCTTTTCATAAAGGTGCCGTCGATAATGGAAGAAATTGGGATTGCTTTAGTTGAGGAGCAATCCTACAACAGTGCTTCAGTAACGCCTTGGCAAAAG
CCGGCAATCGAAAAGTCTGCAGCCACTCTAATGGATTTGGGCAACGCAGATGTTGTCTGCTACAATTGCGGAAAGC