Description :
From Genome Similarity Track
Location :
Scaffold_374:19558- 21325
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_374-fgenesh-gene-0.3Myosin

Sequence
1767 bases(100 bases per row)
GGTGTCGATGATCTCGTGCTGCTGAGCACCGTGAGCGAGAACTCGATCCTCGAGAACCTCAAGATCCGCCACGCGGCGGACGTGATCTACTCGTATATTG
GTCACGTGCTCGTGGTCGTGAACCCGTACAAGTGGCTCGATATCTACGACGAGCAGAGCATGAAGGCGTATACGCACAAAGCGAGAATCGACGTCCCCCC
GCATGTGTTTGCAACAGCGGAAGAAGCGTATCGAACGATGCTGAGTGAAGAGGACAACCAGTGCGTGATCATCAGTGGCGAGAGTGGTGCGGGAAAGACC
GAGGCGTCCAAGCAGATCCAGAACTACATCGCAGGCGTGAGTGGCAGTGGTGCAGGTGTGGACAAGGTAAAGCGCACGTTCTTGGAGAGTAATCCACTGC
TGGAAGCGTTTGGAAATGCGAAGACGTTGCGCAACAACAACTCGAGTCGCTTTGGAAAGTACTTCGAGCTGCTTTTCGACTCGGCAGGACGACCGCAAGG
TGGCAAAGTGACGAATTACCTGCTGGAGAAATCGCGCGTTGTAAAGCCTGGCAAGGGTGAGCGCAACTTTCACATTTTCTACCAGGTGCTGGCGGGATTA
CCGGATGGCGCGCGCAAGAAACTGCAGCTCGATCGTGCGGATCACTTTCAGTACCTCAAGGCAAGCGGTTCCTATTCTGTGGACGACGTGGATGATGCCG
CTGAGTTCGAAGATACGATGGCTGCGATGCAGCACGTTGGCATCAAGCGAAAGCAGATCGAGCTGGTGCTGCAGACTGTCGCAGCTGTGCTGCATTTGGG
CAACATTCAGTTTCAATCCGAGAGCGTAAGCGACGCAGAAGGGTGCTCGGTCAAGAACCGCCGTTCACTCGAGATAGCATGCGATCTGCTTGGGCTGGAT
GCTGACCGGTTAGAGCACGCGCTTTGCTACAAACTACTGCAAACTATGGCGCCTGGAGGGAAAATTGAATCGTACGAAGTGCCGCAGAACCCAAATCAAG
CGAAGGCGCAGCGCGATTCGATCGCAAAGAATGTGTACGACCGACTGTTCGACTTCCTCGTGGAGCGCATCAACCACGCTCTGGACATCGAGAAGAAGGC
AGAGAAGAATGGTGAGATCCTGAACGAAGAAGATATGACCAAGATTGGTATCCTGGATATTTACGGCTTTGAGGTATTTGACAAAAACGGTTTCGAGCAG
TTCTGCATCAACTACGTCAACGAGAAGCTTCAGCAAATCTTCATCGAGCTCACTCTGAAGAGTGAACAGGAAGAGTACGCTCGAGAAGGCATCGCATGGA
CACCAATCCCGTTCTTTAACAACAAGGTCGTGTGTGACTTGATTGAAGCGAAGCGTCCGACGCCAGGCATTTTCCTCATCCTCGACGATACCGTGAAGAC
GATGCATTCGCGACAAGGAGAAGCTGTCGACTCGAACTTCTTGGAGAAAGTCTCGGGTTTGCACCAATCGCATCCGCATTTCTCAAAGCGAGGCAAGACT
TTCGAAATCAAGCATTACGCTGGCGACGTGCAGTACAGCACGGATGGCTTTGGGGACTCGAACAAGGATTTCCTGAGCAAAGACATCGCGCTGATCATCA
GCGAGAGCACGAACAAGCTGATCCGATACATCTTCCCTGAAGAGATTGACTTGAATGACAAGCGCATGCCGCACACTGCAGGGTATCGAATTCGGACGCA
GTGCGAAGCTCTTGTGACGGCTTTAATGGACTGCACTCCGCACTACGTGCGTTGCATCAAGTCGAAC