Description :
From Genome Similarity Track
Location :
Scaffold_134:19557- 21593
Sequence
2036 bases(100 bases per row)
GGAAGTATTCCGGGTACACCCCACCTCCTTTTTTGAGGCAGCTGTGGATATCGCATTGAACGCTAAGTTCAACTTTAAGGCAGCCCATTTTGGCACCCAT
GGGTACAACCCAAACTCGACGAACTCCTTTAGTTCATTCAATAGGCCGGAGCCTATGGACCTCAGCCTCGCCGAGACGGACGAAGAAGCAGAGCTTCGAG
CTGTAAAACAGCATTGAAGCATTCGACGATGTTTCACGTTTGGAAGCACAAAGCATCTACAACCTAATTGCCCTTTACGCAGGGCACGCCAGGCTACTTC
AGGCCGAACTCCCGCCGCTACCCAGAAGTCTGGTACGGTGCAGGAAAACGTAGACTCTCAGTAGGCGTGGAGATCCCTGCTGGGGAAGAACTAGGTTCTG
TTAAGCTTCTAGGAGGTAGTAGCGAGCAGAATCGAGCCCCAAGGAGTCCCGTGCACTCTAACACAGGACGTGAATACAAGCCAGGCTTGTTGGTCGCAAA
GGCGACTGTTAAGTGCTGTGTCAAACCCTGGTCGATTTTGATCGACTCCGGAGCATCCGGTAATTATGTCAGACGCTGTTTTCTTAAAGATAATCCACGT
TATGGTGAGGCGCTAAAAGCCCACAAGGATTATACGATCACTGTTTGCTTGGCAACGGTAACTCTAGTCACTGCACCCAAAGTTCCTGTGAACTTGGGTG
TGAAGTTTTTCGATTTTAACAGTATCGAACGCTCTTTAGCCCTTGATTTAGACTCGAGATATAATCTCATTCTTGGTATGGCTTGGCTTGAGCGCCATGA
GCCATGGATCGACTGGAGGTCGAAACATTAGGCGCCACGCGCACTTCCCCTAGCTGAGCTTTGGAGAGTCATGAATCCACCCCTGCTAGGAATCAGAAGC
GTTATTGGTGCGAGCCACTGGCTGACAATGTCAGTGTGCTGGACATCGGAATGTCAGAGTTAGTTGATTTTGACGATATCAAAGACATGAATATAGAGCA
AAGCTCAATATGTGATAGTGAAGCGGCACGTACTCCGATTAGTGACAGATGTTGTGAGAGCAACACACTGAATACTGAAAGTATTGTTGACCAAGCGTCA
AGTCACCGAGGGTTTGACCCATCAGACGATCGTGGAGTGGCACGTAAGTACCGACTAAGTGACGTTGGCTGTGATAGCGATGCGCTGAATGTCAATATTG
ACGTTGTTGGTGAAATACCAAGGAATACCAAGCCCGGCTCAGCGGATGCACGTGAAATGGCACGTAATCTACGTGATGACAACTTCATGTCAACTGGCTT
GTAATCGGATGTCGATAGCAACATCAGCTCTAGTTTCGAGCAAATTATGTTTAATAATGGTATCGATCAGAGAGATACGAATCACATAGCGTGTTCTGTG
GCACAAAGTAATGATGACTGTCAGCTGTATACACTCTTCAACGGAGTGACTGGTGCCTGTGACGGTACAATTAGCCTTGTGGCTATACCCTCGTTAAGTT
CGCTTTTAGAACTCGAAGAGTTGTCGGTCGATGAGTTTGATCATTCACTAATGAATGGAGACCTTTCAGAGGTGGTAGTCATTCGACCCGACATCATAGA
GTTGAACCCCTCTTCACTTTTGGGTGAAGCCGTTATGGAAGACACAAAAGCAGCAATCAGTGCACGTAGTGGGTCACCAATATTGAAAAACCCTCATGAT
CCCTTTTATTCCTCAGTCAAGGAATTTCAAGATGTGGTGTGCCACGACCCACCCTCGGTTCTACCTCCAGATAGAGGTGATAGAGGTGTCCGTCATGAAA
TTGACTTAGTTCCTCGAACGAAAAAATGTGTCACACGACAGTGGCCCTTGCCTCAGGAGCAATGTGATGTCATTGATGACTTCTTCCGTGCCAAGCACGA
GGCAGGAATGGTTCGTGAGAGTAAATCTTCATACTCGACACCGATATTTTGTGTCAAAAAGCCGAACGGCAAGCGGAGTATTGTGCGTGCTTATGACAAG
CTTACTCCGGCTACGATTCCGCCCAGACACCCATTC