Description :
From Genome Similarity Track
Location :
Scaffold_129:19553- 44567
Transcript NameFunction/comments
Physo_143093Pcf11 CG10228-PA
Physo_109536molybdenum cofactor biosynthesis protein C
Physo_143095hypothetical protein
Physo_158691hypothetical protein
Physo_143098hypothetical protein

Sequence
25014 bases(100 bases per row)
CGCCTGCATTCTTCTCGTTCTCCTTCTGTGTCCTGTCGAAGAAGCTGCTGCTTGTGCTCTCGCGAGGTGCCGTGTCTCCAGAGAAGTCGGCCACCCACTG
GTCTTCATCCGGGTACCACGACCGTGACACGCCCCCCTTACCGCGCTCCTTCCGCGCGCGGTTGTACTGGAAGAGGAAATCCAGGTGAGCATCCAGTTGG
GCCTGCTCACGGAAGCGCAAACCACTCTCACGACACACTAGAGGTAATGCTGCATACAGCTTTTGGACGTTGGATTCTACACGGTCCTTGTGGGCCACAA
CCTTGTCGCTGAACCACATGCGTGACGCATTGTCGGTGCGAGGCGCTTGCTGTTGCTGGTCACCTTGCTGCTGTTGCTGCTGGGGTTGTTGGGCTTGCTG
CGGCTGCGCTCGCGGGGGTGACGGCCCGGACGCTGCGCCTCCATTCGACATTCCCTTAAGCTTCTGCAGGATCGACATGACTGCTGCTGCGTCCGGAGCT
CGAGGAGGGTCGTTGGTGATTTCTTGGACTGGTTGTTGCGGCGGAGAGGGAGCACGCTGCTTCCGCTTCAGTAGCTGCATCAAATGAGCAACGTTAGACG
ACTTGGCTGCCGAGCCGTCATCACTCTTGCGAGATGTCGAGCTTGCACGAGGTGGCTCCACTCGAGGAGCCTGTGATGGAGGGGGTGCAACCTGCTGCTG
CTGCGGTGGAGGTCGCGCACGACCAGCACGTGGGTCATGGGGAGGTGAAGGGCGGCGGGGGTCTCGAGCCACTGGGGCCTGCTGCTGCTGCGGAGGAGGC
TGCTGTCTACTGGGAGCTCTCTGAGGAGGGGCACTAGAAGCACCAGGTCCTCGTGCTGCGCCTGCCTGCTCAACCTTCGAGGCGGCAAGAAACTCGAGCA
GCTGGTTGTAATAATCTGGGTTATTCGTACGCACTTCTTCAAGACTCATGTGCTCCGTCGGGTGAATGCCCATGTCGTTCTGCAGCTTCGTGAGCAGCGA
CCGCAGCTCCATGTCTTGCTGCTGCTGCGCGAGCTTCGCGCCGGAGTTGGCACTTGTAGCACGAGCCTGTTGGGCCGACTTCTCCTGGTTGAAGCTCGCA
GGCGCCGACCGAGCCGACGGATCCGCCTGGTGCATGGCGCGGTTCGCAGCGCTGCGCATCTGAGCGATGGCGTCCTTGTCAAACAGCCGCGTGGTCTCCC
ATGTATTCAGCACATGAATGAAGCGCTTCAGGTCCTTGCCCGACACCTGCAAGCAAGTATCCATACACAGCACAATCCAAAGCGTTTAGGATCGGCGACA
AGTAGCGTTTTATTCTTCGTACAGCAGCTACACAACTCAAAGTAAGGCGTTACCTGGCGCACACAGTTGCAGTAGAGCGGCACGATCTTGGCGGCGAACA
GCGCCAAGTACGGGCCTCTCACGTTCTTGAGGATCGAGTCTGTCAGGTAGAAGATCGGCAGCTTGCAGTTGGGCGCAACCTGTCACCACACAAAACACCA
CACAAGACAACATCAGCTTCACGGCTCACTCGTAGCTACTGCCAACCTGTCCTACTAGGTAGCCGCCGCACACAGCGAGTCTCTCCATCTCTACGTATCA
CGTCTACTCAATTGCACATTGGTGCAGAGGCGGCAAATGGACTGGGGGTGTCGAGCCGACAGACAGTAGGCAGCTGACTAACTGGTGTGCATATAGTGCG
TGGATGGATAGATAGAGAGACGGGAGGAAACTAACTAGACATGGCTCCGTGACAGGCTGGAGGAGGGAGGGTGTGTGTGTGCATTTACCCGGTGGATCTT
GGTTTCCAGGAAGCTAACAATCTCGGGGGCGAACTGCGTGCGCTCCGCCAGCATCGTCAGCGCGTTGATCGTGTCCTTGGCCGGGTAGTCCATCATGGCG
TTGATCTGCGCGTCGAACTGGCCCAGCAGCGACTGGATCTCCGACTTGGCGGCGGCGCTGGAGGAGGCGGACGCGGAGCCGGAGCTGGCGCTGGCGCTGG
GCGTGGACGAAGCGAGCTGCGCCATCGCCATCGGTCGGGAGAGCGGCGGACTGGGGGCGGGCGACGGCGAAGGCGAAGGCGAGGGCTTCGGCACTGAGCC
TGCTTGAGCTTGGGCCTCCTGGCTGGTGGCTGGCTTCTTGGTCTGGCGGAATACGCGGGCGTTTGCTCATTCGTTCTTGCAGGTCTGACCCAAGTCCGTC
ACAGAATCTGAAAATTACCCCTAGTATCACATACTAACTTCCACGAAAATGATCAAAAGTAACCTATTTATATATCTCAATTTACAAATCTGCACTGCTT
TGCTACCTCGTGCACTGATAACCGTGACGATGCTGCGCCGCGTTGGTGCTGCCCGCCGCCTGCCGCGCTCGTGGTCGGTCCGCGCCGCGTCCTCCAGCCC
CAGCTCCAGCTCCAGCTCCAGCTCGCCCGATGACCAGTGGAAGTTCACGCACGTGAGCAGCGACGGCGGCGCCCCGCGCATGGTGGATGTGGGGCGCAAG
CAGGTCACGCGGCGCTCGGCCACTGCGCGCTCGACGATCCGCCTGCCGCCGGCCGTGCTGACGGAGCTGCAGCGCCTCCAGCAGGGCGGCGGCAAGAGCG
ACGACGCGAGCCAGTTGCTGGGACCCAAGGGCCCCATCGCGGCCACCGCCGTCATCGCCGGCGTGCTGGGCGCCAAGCAGACGAGCGCGCTCATCCCGTT
CTGCCACCCGCTGCCGCTCGAGGACTGCCAGGTGCGGCTGCAGGTCGTGGGCCCCGACGCCATCGAGGTCGAGTGCCAGGTGCGCGTGACGCACAAGACG
GGCGTCGAGATGGAGGCGCTCACGGGCGCGTCCGTGGCCGCGCTCTGCGTCTACGACATGTGCAAGGCGCTGAGCCACGAGATCGTCATCGAGAACACGC
GCCTGGTCGAGAAGACCGGCGGCAAGAGGGACTTCTCCAGCAAATAGTTGCATTGCCGTCCGTGGTGAATAAATAACATAGAATATATAAACGAGCTTTA
GCGCTTGCTTCAGCCGTCCGAGTCGGCGTAGTCGGAGCCGAGCTCCTCCTCCATCTCGTCGTCCGAGTGGGTTGCTGCCGGCTGCGGGGCTGCAGTGGAC
TTGTGTGTGGCGGCGGGGCGGGGCGAGCTCTCTTCGACTTCCTCGTCTTCGGCGTAGTCCTCTTCGGCGTCGTCTTCGTACTCGTCGGCTGAAGCTTCGA
CCGGCTTGTCCTTCTTGGGGGAGCTGGCTTTGGGGGGCGAAGCGGGCGCGTCGTCGTCTTCGAACTCGTTGTTGTAGTCGTCCTGGTCGTTGGCGTACGC
CTCCCCCTCCTCCTCGGCTTCCTCTGGTTCGTCCGCCACCTCTTCGATCTCCTCCTTGCGCGCAGAAGTTGGGGGCTCGCTACGCGTAGTCGTCAGAGGA
GGCACTGGGTCTGCGGCCGGCTTCTCTTCCTCGCCGTAGTCTTCGTTCTCATAGTCTTCGTACTCGTCTTCGGTCGCTGGCGCCTCCGTGACAGCAGCGG
AAGGCGCTGGGATCTCCACAATGGGGGCTGCTTCTGGGGCGGCAGATTCGTTGTCTTGGTCTTCGAACTCGTTGAACGCGTCCTCGTCATCGTACTGGTC
TTCGGTCGCTGGTCCCTCGCTAGCTGCAACACCAGGACTCTCGATTGCGATCTCGTCCGGCGGAGACTCGACAACGTCAACTGCAAATTTCTCCGAGGAT
TCAGGAACATCAACAACGCCCGCCTGCTGCTCAGGCTCCACTCGAGGCGTTTCCGTCGAAGGAGCTTGTTCCTCTACCGCTTCGTCTTGGATCGATTCAG
CAGGTGCGGGGTCAACAAGAGCAGTGGCTGGCGGTTCATCTTCCGGTGGATCGGCGTAATAGTCGTCAGGCTCGATGGAAGTTTGATCCTCCGGAGCTAG
GTCGACTGCTTCTGCTGGGTCTGGATTGGCTGCCTCGGGCATCGGTTCCTCTTTCATTTCGGAAGTATCACTGGAGACGACTTCACCCGTGTTTTGGACC
GCTTCCGTTGCTCCGTGATCGTCGTCGGCATCAAGATCGTCAGGATAAACGGGGTCATCAGCACTTTCATGGACTGGAAGCTGTGTGTCTGATGGCGCAT
CGACTTCAAGGCCGCCCTCAGGCTCGGTATGATCAGGATTCTCAGCTGCAACCACGACGGTAGGATCTTCACTCACAGGGGCTTCAATGGGAGAACTTGC
AGGTTTATCAGCGGATTCGACGGTAATGATCTTTTCACTGGACGCTTCTTCTTCGACGGCGACATTTTCCATGACCTCAGGTGCATCTTCGTTAACCGAG
ATCGGGTCGTTTCTCTCTTCGACGACTTCCTCCTCATCCTTGGCGGCAGCCTTCATAGGCAAGTCTTCATCACTATTGCTAGTGGCAGGGTCAGCCACGT
CGGGAATTTCAGGTGTGAGGTCTTCAGGGTTAGCTTCTGGTGTAGAGGGCTCATCAAGAGGCGAGTTAGCGGTGGCATCTTCCAGAGTGGGTTCCAAAGC
AGGAGCAGAGTCGGCTGTGGTACACGCATTCTCCACATCTTCAGATTGGGCTGCGTCTACAGGGACGGCCTCAGATTCTGTGGTTTCCGTCACGGAGTTC
ATTGCATCGACTGCCTCAGACTCGTGTACATCGGGTTCAGGTGCTGCTGCTTCCGTTGTTTCAGCTTCCAGTGCCGCCGTCTCCGTTGTTTCCAGCTCAC
CAACATTTGCTTCTGCTAGTTCGGACTGTACAACCTCGGACTCACCAGATTCTGGTGCAACCGACACAGGCTCGGATTCGACAGCGCTTGGCTCCGGTGT
CACTACAATCTCAGGCTCGACAAGTTCCGGTTCTTCGGCCGTCACAGCTTCGGATTCAATAGCCTCTGGCTCTGCCGCCGACACAATCTCGGATTCAACA
GCTTCCGGTGCGGCAGCATCGGGCTCAAGAGCTTCAGGTTCTTGACCTGACACAGCCTCGGGCTCGACAGCTCCTGAATCTGCAGCTGGTATAATCTCGG
ACTCAACAGCATCTGGGCCTTCAGTCGCCGCAGCGTCGGGCTCGACAGCTTCTGGCTCTTGAGGTGCATCAGCCTCTGATGCTTCAGGTGCGACAGTCTC
GGGCTCAACCGCTTCTGGTTCTTCAGCTGCGTCAGCTTTGGGCTCGACAATATCTGGCTTTAGGGAAGGAGACTCCACAGGATCCGGTTCTTCCGACTTC
GTAAACTCATCATTCACCATGTCTGCTTCAACGCCTGTAGGCTCTGTAAGTTCGGTCTCCACCGATACGGCTTCGACATCATTACTCTCGGCTGCTGCTT
CGGGATCAGTTATCGCTACTTCAGAAGTCTCAGGCTTGGCTTCGAGTTCTGCGGCTTCGGGATCGACAACTTCAGATTCCACAAACGTCTCCGTTGGTTC
CACTTCGACTGAGTTTTCTGTGTCGCAGTCTTCGGGCTTTACTTCCTGCCCGTCCTCAGCAACAGTTTCTGCACTAGGATCAATTTCACCCTCGATCAGC
TGATCACTTTCAGCTACGTCAGCATCCGGAGGGGTTTCCAACGTAGTGCTGACGTCGACGTCAGCTTCAACGGCGGCATCTTCAGCAACGGGAGTGGAGT
CAACCCGATCGCTCGGGTCAACAACTGGAGTAGTTGTATCCTCATCAAAACCTTCATCGTAGCCCTCGTTACTTGGAGATGCGTCCGGAACCTCGTCGAC
GTCAGGGGAAGGTTCTGCACTTTCAGCAGGAACGTCACTTGCAGCGGATTCTATTGCGGGGCTATCAGAATCGGCCACAGCATTGTCATCACTAGTGGCG
GCTTCTTCTGAATCGCCCATTGGCACTTCTTCATTCGTTTCAGGTAATGTGTCGGACGGGAAGTCCTCCTCATACGTCGTCGCATCTGGGCTCGACTCAA
GACTCGGAGTGTCTGCATCGGGTGCGTTGATGATGTCGTCGCTTGGGTTACCAGAGGCTGCTTCTGGAGCATCATCATCTGCAGGCTGGCCGCTTGCTCC
CTCGTCGTTACCTCCACAGATTTCTGCTGTTGCCTCCGCGGGTTCGGCCGGGTCTTGATTCATTTGTGTTTCGTCGCTAGCAAATGCTGTGGCTGGGTCT
GCCTCAGCCTCCTCTGTTTGGAATTCAGGATCATCATAAACAACCTCAGCGCTCTCCTCTGGCTCGGCGACATCAATAGGAAGGGTGCTTTCTGTCTCGA
GGATTTCCGCCGCCGCAGTTTCTTCAGTTTCACCAGGACCTTCTTGAGCAAGTGAACCATTAAAGGCTGCTTCTTTCAGTGCAGTAGCATCGTCTTCAAC
TTCATCAAAGTCGGCGTCCCCATACTGGTTCTCCTCTCGCGTAGCTTCATCTGAAGGCTCCGCTGAAGTGTCTGCCACTGCAGTTACAGCGACCGGACTT
TGGTCAGACTCAGGTGAGTCTCCGGCAAGTTCACCGCCGGCCTGCGTGGAATCGGGAACTTGCTCAGTTACAACATCTTCTGCTGCACTCGGCTCGTACT
CATTTGCAGGTGTTTCAACAACGTCCGAAATCATTGACGGTGGCTCTGATTCCGGTGCTTCATTCGCTGGGGCAAGGTCAACTGCGCTTTCAGGCACAAC
ATCCTCATCAGCATTATCCTGAGCAGAGGCAGAACCCTCCTCACCGATCACTTGTTCGTTTGGAGCAGCAGATTGAAGTTCAGGCTCGGCCGATGATGTA
GTTTCAGGCTCAGGTGCTGGCACTTCCGCCGCAGTGACAACTTCCTCATCAATTGGGGAATTTGGAGTCACATCGTCATCAGCAGCCACGGCATCACCAG
GTTCTTCACCTGACGCGTCTACATCATTTGCAGCAATTTCATCTTCGATAGTAGGAATCGACTCGCTTTCAATAGCAGGCTGCTCTTGCGGCTCATCTGC
CTGCAATTCAGGTTCAGAAGAGACCACCGCAGATTCATCAAAGTTGCTTTCTGCAGCTGAAGCGCCCTCAGCTTCGTTGGTAGTTTGTTCTGACGATGGC
TGAACGTCTGGCTCGTCGTCCTTCAGGCCTTCATCCATTTGTACGACTACAATAAGGCCAGAATCCTGGGTCGTCAATGACGGAGGTACCTGCTCTTCTT
CTCCACCATTATCGAAGTCGTCCTCATCATACGTCGCTGGCTGAGCACTGACATCAGGTTGTTCTGCAGCTTCTTCCTGCGTAAGGTCATCTGTTGGGAT
TGTAATTTCAGGAAGCTGACTGGCATCAGTATCAGTCGGCTCTGAAGGAGCGGTAGTGCTTTCATCACTGTCAGGGAGAGGATCAGATCTTCCAACGGGG
TCTTCAGTGGTAGCATCCGATTTTGTATCGTCTCCGTTTGCATTCTCACCGGAGTTCTCCGTTGGTGGGTGGTCGTGGTGCTTGTCTGATTCATCCACGG
CCTGCTGGTCTTCGGCAGCCTCGTCCTGGAGCACAGTACCTTCAACTGCTGGGACCTCAGCAACAGTCCCGGACTCGAACATCTCTGCGGAATCACTGGG
CCCAACTTGTTGTAGTTCTGAAGGTTCATCGGTTGTCTCTGTATCCAAAGCTTCGTCAGCATTTCCCTTTGATGACTCACCTGGTGCAGTATTGTCGAGA
TCTTCAGCCCCAGAGGCCACTGGCTCGCTCGGAGCTTCACTTTCTACTTCAGGTGGTGAAGACGCTCCATCGGCTGGTGCATCCGTTTCAGGTAGTGCAA
CCGGTTCATCAACCTCAGCGTCTTCATCTACGGTTGGTTGCTGATCAGGTATCTGGACTTGAGATTCCGAGTGATTTTCTTGAGCAACTTCTTCGTGTGC
ACCGTCGTCGAAATCGTCATCTTCATACGCCTCTGACTGCACGCTTAGCTCGGAACTGTTAGCTGTTAGCCCCTTGGAATCCTCCTCCTCATTATTGGCA
TCAGGTGTCGCGTCATTTGCATCAACCTGAGCGTCGGCAACTTGAGAAGTTTCTTCATCTTGTTCCTGCTGCGGATCCACCAAGTCAGCTGCCTGGTCTA
CAGGCTCAGCAGCTTCTTCGGCCGGAGGGGAGACGGAATTAACATTAGCCACGTCTTCGCTTGGATCTGCTTCTATGTGGCCCTCCTCATCGAAGTTATC
TTCATCATAAGCTGCAGACTGAATGCTAACCACGGACACATCCGCCAACAGGGTTTTGCCCTGCTCGTTATCTTGCTCCGTCAAAGGTGCCGACTCATTG
GCCTCCAAGCCCTCGGTAGCAGCTTCAGTGACTTCAGTCGAGTTGTCCTCATCTTGTTGAAGTGGGCTCGGATCAGCTTGTGCTTCTTCAGATGCAGGGT
CAACGAAGTCTGCTGCTTCACCCGCGAGATCGGTTGCTGGGGCTTCTTCCTCCTCAGCTGCAGCACTTTGAATGCCAGCCTCAGCGTCTCCCGCCTCATT
CTCCACCACCGTTGGCTCAGTCACCGAAGTAGTAGTATCCGCTTCTGGACTAGACTCTTCCTCGAGGGTAGCGCCTTCTGCACCCACCAAATCATCTGAA
GTATCATTACCGCCGGCATCTTCCGTGGCGACGGGCTCATTTCCACCACTGCCATCTAAGTTGCTGTCATCAGTCGGATCTGGTACAGATTCACCTTCCA
GATTGGGGGACGTGCTTTCGTTCTGTTCCTCTTCGGTGTTGCTTACGAGTACATCCGGATCACTTGTAGATTCCTCCGAGATAACAGCGACGTCTGCCGG
GTCTGGCTGCGGATCATTTGATTCTTCTGGCTCAGCAACCGCGCACTCAGTTTCACCACCACCGGCATTGTCATCCACATCGCCACCCTGCACCGCACTT
TCAGCCTCCGCTTGCTCCTCTGCACGTGAGCCGTTCTCAGCTGGGGCATCAGGAGGATTATCATTTTCAGTATGCACTTGCTCATTTTCCGTCTCGATCA
CGCTTGCTGCTGGTTCAGACTCACCAACTACCGATACACCAGAAGTTTCGTCTGTTGTTTCTGGCTCAGGATTGGCCTCAGTATCAGCTGCAGGGACATC
GTCCGCCTCGGCTTCTTCAGCATTTGGTGTGTCGTCCTCATCGAACTCGTCATAGCCATCGTCGTACAAGGCTTCTCCACTCTTGCTCTCCTGCAGCGGA
ACATCATTTGGAGGATCCGATGCTCCCGTGTCATGCATAGGAGTATCTTCTGCATCTGCTCCGGCTTCAGCTGTCATATCTTCATCATCGCCGCCGTTAT
CATCAAACTCGTTGTACGCGTCTCTATACATGGCATCCACCGTCGCACTTCCTCCACTTGGTTGGTCTTCAGCAGGATCCGGCATTGCACTCGGCTCCTC
CAAAGGCGGTACAGTAGTCTCATGTGCTTCCTCTGTTGCCTCTGGTACGTCCGTTGCAGCCTCGACATTCTTCTCTGTGGCAGCGTCAGGAACAGATTCC
TCTTGCGGCGGCGGAGCATCAACAGGGGAAGTGATGGTCTCCGTCTTGCTTGGTGTTAAAGCTATCGCCGTTTCTTCAGCCGTAACATTTTGCTCAGGTG
TGTTGGATGGCGAATTGTCTCCTTGTGCAGCGGGGTCTACCACTTCAGTTGGTATCTCCGATGGTGCAGTCTCCACCTCAACCGCAGCAGCTTCGATACT
ATTCGAAACCTCTGGTTCCACTTGCTGTGTGGGTGTCGTATCTGTTGAAACAGGGATTTCATCGACTGTTTCGGGCGATGCCTCCACAGTGACAGCATCC
GAATCCACTTGAAGCGGCTCGTTAATCGCTGGGGTGCTAGGCGGAACGACTTCCGCAACTACTGCAGTAGCAACAGACTCCTTCACCCCCTCAACTTCCT
TCTTACCAGCAGATTTCGTAGCGGCACTCTTGTTTGACTTGAGGACAGTCCGAGGCTTTTGCTCTGAAGTTACCTTTAGAGGCACAACGGGCCGGGAAGC
GACTTGCTTGGCCCTTGCGACCATGGGTGCTTGATGACCAGACGGAGTTTGGTGACCCTCACTTGCTGCAGCTTGGCGCTTGGACGCCCCGGAAGTCGGC
TTTGCAGGCCTGACCTCGGTTGATTCCCGTGGCGACAAAATCTCCTTCGGAGTGTACTTCGGTGTGCTGCTGACTGCTGGACGCGACTTCTTGGAAAGCG
GGCGCTTGTCATCCGAAGATGACTCACGAGTCTTTCGTGCTGTCTTCGAGCTCGCCGAAGACTTCTGCCTTGAAGTGTGGTCGACAGCGGGAACGGGCGT
CGTGCTACCGTTTGCCAACGTCGATTTTGCTTTGTCAATCATCTTGTGGAGCTTTTCAGCGAAGCTCAATCGCTCTCGCTCTCGGATCTCCTCTTTCTCC
CGCGGTGTCAGCTTGGAGCTGGAGGGGATGCCGCTTCCTGCACGAGATACGTTGTCTTGGAACAACTGCGTGGCGTAGTCGTTTAGTGACTCAGAGGAGG
TGTTGTTCGACCTCCTGGTCAAAGACGAGTAGCCTCCAGCAGTGATTCGCTTTTGGCGCGCCTTCGCTGCTCTTTTAGTCGCAACACCCAAGCGCTGAGG
CGACGGATACGGCGAGCGAGTCTCTCTGGACACTCGAAGCTGGTTCTCGTTCTCAATTTTCACCTGGAAGGCAGCTCGGGGCGCTGGGTTCTTCTTCTTC
CGCTTTGCTCCTCGAGGTTGCCTCACTTCGGGTTCGTACACGGCAGCGTGGTGAGGCTCGTCATTGTCGTCCCAGCGATTCTGACGGCTCGACATGAAAT
CTCGGTGCGAATAGGCCGGCCCATGGTCCACGTAATCCGATCGACTAGAGTAAGGTTTGCTGCTTGATGGGGCATGTTGCTGCGGTGGGGCCCAAGCGGA
TTCAGCGGACGCCAAGTGTGCTCTTAACTGAGCTCTCTTTGTTCCATAAGGTCTTCCGTTGGCAGCGCTGGGTACTCCCTGGATTCCGTACGCGTCAAAT
AGCTCCGATTGCCGGTCCTCTTTCGATAGTTGTTTCCGCTTGCTGGTGGAGCCAAATCCGCTGTCCATACCTAGACTTCCGTCAAGTATGACAAGGCTGC
TTGGCTGCTGTGGAGCCGTAGCAGCCCCAGGGAAATCACGAGCAGGGTAGCCAAACGTGCTCGTATCACCTCCAAACCCAGAAGCTCCTTGTCCGTATGG
AGATGCCGCCTTTGGGAAGCCTTGCGTGTGTCGATAAGGTGTGCTAGAGGTGTAGGCAGCCCCACGGGGATACGAAGGGGCTCCATACCCTGTGGCCGGG
TTGCTTTTGCGCTTCCCAATGCTGGTAGATCGACCTCGAAGTGAGCTTTTCTTCACGGGCTGCCTATCTGTGGGAGTATTTTTAAGCGACTCAGCCTCCC
GTAAAATCTCTGTAGCGGTGTCCTTGATTCTCTTCGTGGGCGATTGCCGGACAGTACAAAGTGCAATTTGCTTTGACGCTGCAGCAGAGTACTTTTGGAT
GCTTGGTTCGGTAGGGTATCTCGCCATAACAGTTGAAAGTTCAGCTATTCCATTGAGACCCAGGATCAAGGCAGCTGCACGCTTTCCACTGGCCGCCAAA
CTGGAAGTGAAATACACACAATTATCCAGATAAATGAGTTGCTCGAACGCACAATTAGTTTCCAAGCCACCTTTATCTCACTCATGATCCGTACCACATG
AGTAAGCTACCGACAGCGCAGCAAGCCTTCTTGTCATCGAGTGAAAGTCCTTGGCGCAACAAGAAGAGCAGGAGAGAGATCGGAGCCATATCTCCCGTAA
AGTCTTCCTCCTGCTCACCACACAACAGATTCAGCGTTTGAAGATCGTCCAGCTCGCACAGCTCCAGCAGAACTGCAACATGACGTCAAAACCATATCGA
CAAACCGAGTCAAAACGAGTTCGATATGTATACATCAAAGGCGAGCACGTTACCTTCGCAAGCGTAATAATGTACTTGCCGCGTGTGTACGCTGTAGGTT
TTGTGATAGATGAGAGTGGATAGCACTAGCTGCGCCACTTGGTACTCGATAAGAATGTTCAAACCAGACTGGACTCGCGTAAATACAGCTAAAGCTCCAC
AGGCAGACGCTTGAAGAATAGCGTCCTCCGCAAACGCATTCATCGCTTGGATCACCAACTCCACGATTCCATTGCGCAGCAAATAGTGTGTGCTTTTCAC
ACACAAAAAGCAGAGTCTGCGCAGGAGCACGAATCCGTAGCATTGAATGACTGCGTGAGACTGATGAAACTTGAGCGCGTCGATAATTAAACGCTCGCCG
CCATGTTTGTGAACCAGATTGGCTGTGACTTGGGGATATGCACGCATCTGCTTGACCAACGTTGAGAGAACCGACTTGGTAGATGCCGAGTCACCCAGTC
GCTTCTCCAGTAGCTGGAGCGATTCAATAATGTACGCGCGCTCAGCAGACACTCCCGCAGGAGAAGGGTCGGGAAGCTCTTCATTTTGGCGGCTTGGGGG
GAAGGCTTCGTTGTGCTTTGGCTGCTCAGGTCTGGGATGATCAAACTGGTCCGATGTTTCGGCTGTCACTGGCTCGTCGGACTTGTCATCACCGTTCACG
CTCTCTTCATTTTCTTGTGCTACATCCGCGCCACTGAATGTATCTTCCGCTGGGTTGTTGGGAGACTTCTGTGCTTCCTCCATTTCTGCATCCTTTTCGT
CGTTCTCGTCCTCCTCCTGCTGTTGCTCGGGTTCTACATCGTTCGGCGTTTTCTCCTGTTCCTCTTCGTCTGCTGCACCCGCAGCCTCTGCCTCGTCCTT
CTCCTCTTCCTTGGGCTCCAGAATATGAGCGAGGGGCACGTCTTCTTCCACCTCGCCGTCATCGTACGCAATGGTATACCTTCCGTTCTCCTGCACATCC
GAAACCTGGCCTGGGTAATACTCTTCTCCGCCATCGTAACGACAAAGCACACGAGTTCCAACACAAATGGTGCCAGGCACATGCTGGCGAAGAAATTCAG
GTCGCACATGCGTCTCCACTTCTCCATCGTCGTACAAAACTTCAAACGTGGGGCCGTCTGCGCTGTCAGGCTCTGCTTCGCCTGCATGGACGCATCGTAT
CCGCCCCGGGTACCACATATCGTCGGAGTTTTCATCGTATAGACCGTCTACGCGGTCGCCAACGCGATAGATCGCTGCCATGTTTCGTGTAGTTTCGTCG
TCGGACCCCACTGTAGCAGGCTGCACCAGTCAGGTACTTCGGACACGCTCCCTTCGTCCCAGCCAGGCTATGTTCCACAGGCGATTGCAGTCGTAAGTGG
CGTCTCTCGCTGCAACACCCGCTCGATGCGATAACCGACCAAGAGCCCCGTTCGTTTCCGGCCAATATTGGCGTCGACCCTTCATTTCCAAGGAAAACTG
CCGCCCCACAGCAACATGTTACCCCCAACTAGCGATCGAGTTCTTGCTTGACGGCACCTGCATCACCGCAACTGGCCAACAACAACAACACCGCATACTC
GCATGCTACGCGATCGTACCGGTGTCTTCAGACGAAAACGGACCCACTCTTCACCTACACCGGTATTGCAGCCAATGCAGCATCACGGAGCAATGAAGTA
CAGGTCGACAGAGGGAGCTCAATGTCAGTCAGCCACACCATGAGCAAGCAACACGCAGGGACATAAGAGAGCAGACATGAAAAATAAAAGCAAATAACAT
TCCATTCGCAAGGACCTCGGACCGAACGCCCCACCTCTCCATCTCTTGTTTCTCGGCTGTGCTGTACCCTTGGACCCCCTCACCCACGGAGGGTCCCATT
CGACCTCGCAAGACAGAGACGCAGGACGTCAGCGTCGCATAGTTTTGGGGTTTCTGAATTGGGCGTCTCAGCTCATGGACATCATGGGCTGCTGCTGAGC
TTGTACCACCTGCGGTTGGCGCGCCTTGCCCGCGCGGATGTCGGCTATGAGCTGCAGCACCTGCTGCCGGTCGGCTTCCACCTGCGCTATGCGCCGCTCG
ACGGGCCACTCCTCGAACTTGACCTGTATCTTGGCCTTGGCCTCCTGCAGCTCGCGCCGGTCGCTCTCCCGCTTGCGCGCGATCTTGTCGCGCAGGTAGT
CGCACTGCGAGACGGCGCAGCGCTGGCCCAGCGGCGTCTGGCACGTCTTGGCGTGGAAGCAGAGCAAGCCCCAGATCTTGGAGCACATCTCGCAGCTAAA
ACCACGCGCATCGTCACGTAAATCAGAGGCTCTGGGAGATTAAACCCACGGCGTAGTTTAATCTAATTTGTAGCGGCGCACCTCTCGATGGGGGAGACCT
TGCGGCGCGGGCCGTAGCAGCGCACGAAGTGGTCGATGCTGGCCTTGACCTTGTGGCAGCGGCCGTTGAGCGCCTCGCACTTGGACTCGGGGCACGTGGC
CGCGTGCACCAGCGCCTCGTTGTACACGCGGAACTTCTCCTCGTGCGAGGCGCCGCCCTGGTCCTCCATCTGCACGTCCATGGCTCGACTCGAGGCAATA
TAGACAATCGCTTCTTCTGCTTGATGGAGTTTGACCGCGCCCGACCCGGAAATAACACCACGCGCAAACGTTCCCACCCATGTTGTTGCGTTACAACAGG
ACTATTAAGTAGCAAAGGCTAAAGGGGCACTTAATAACAACAATGGGATAAGTTATGACAGGATACTAGTTTTCAGTGTATAGGAAATTATGCGCGTATT
GACAGCAAATACATTTTTTAGCAGGCTAAGAAACAGATGCCGATGAAAAACAAAAGACGGAGTCCCAGCTGGGCTCTTCAAGCAGAGCAGAGCACACGAG
GGACGGCCTCGAGTCAACGAGCGAGCGCTCGAGTTAATGATGGCGGCGTGCAGTGTACAAGCTTGTACTACACGACGCCCGCCCTCGTGAGAAGCGGGCG
CCAACCGCATCGCATCCGTGGGGCTGCTTCCGTTACCCTCCAACGATACCATTGCCTGCCCTGGCGTAACTTGCAGCTCGCGATCCATCTACCGCTCACC
TATGGCGGTGCGAGTCAATGCATGCTTTGGATGGACAGTGGTGGGGTGGTTCATATTGATACTTAAATAGGTGCGCGGTCTACTACAGTGCACATGTAGC
TCGGCTTGCCACGCAGGATCCGGGGGCCAACGCCGTCACGTCAAAAACTCGCGAGGTGGGGGACGAACAATACAGAGGGCGGTCGGTCAGTCGCCAGCGC
CACCGAGGCTGCTTCAGCCGCCGCAACATTAGGCCGAGCAAGTGCGGGCCTCGGGCAGGAAGTGCGGCTCGTGGAGGTCGACGAGGTGGCAGCTCTCGAC
CAGCTTCTGCTGCTGCGGGTCCAGGTCGCTGTAACCCTCGAGGCACTTGAGCGGGATCTGGCGCACAGCCTTGTAGCACTCGACGTGGTGCCAGTTGATG
CACACGAAGCCGTTGCGGTGCTGATAGACCACGCCCACGCGCAGGCGCCCGGCCTCGATGGTGGCGTCGCACGACTTGCAGCAGGCGTGCGCCTTGCGCG
TGGCCTCGATGATGTACGTGCCGTCCTTGGTCCAGGGCGACTCCATGGCGCTCGGGCTCACGGGGCTGCCGATGGGGCTGGCGCTGCGGATCTCCACTTG
GGTCATTGTTACTACGGTAGTTACGATCGAGAGAGGGGTGTGCGCGCGAGTGAGGCAAATGCGAAGTGAGCTCGCCTTTGCTCGCTTGACTCGGCGAGCA
GCGCGGCTCGGCCAGCTGGCAGCCAAACGAGGCGAAGCGCGGCGCGGGAGCTTAGCGGATTTCAGAGACGAGGCCCGGGCTCACAAGAGAGCAGGCGCTG
CAACGGCCGCGGCCATAGTGAGCGCGAGTCAAACAAGACGGTCCGACTGCGACAACCACCGCGGGCTGACGCCGCGGCTGTCATGCCGCTGGCCGGACGC
TTGTTGCTGGCAGCGCGCTATGCTAGACTTTTGCTGGCAGGCAACTCATGCTGGTTGTTGCTCGAGCTAATGCTAAATTTGCTCGGCGAAACCGCGCTCT
CTGAATATTTGGATCCCGGGCGCTATCTCTCGATAGATTCTAGCACTCTCGCCGCCGCATGGCGAGCCGCGCCGTGTTACGAAAGCAGCTGCAATTGCTG
GGTGTGTTAGGGGCTGCGTTTCTGCCGCTCTCGTTCCGACGTCGAGTGCAAGCGATCGACCACCCGGCCCCGATCGCGTGAAAGGCGGGCCCCGAGCACG
GGCTTGGCCGCCTATCGGCCGCAGATTCCGCTCGCCATGCGCGAGACCAACCACCAGCACCTGTCCTGCCAGCTTGTTTGCTTGGTTGGCTCGACTTCGG
AGGGCCGTTTCCATTCAGAATTTCGCTACTAGTGGCGGTTATTGGATACCGTTGCAGTGCACATATCGCGGGGGGGGGGGGTCTTATTCATGCAAACTTC
TCCTATCTACACTTGGAACCCCTCGGATTTTCACGCACATCTAGTGCATTCTCGATTCAAATGATAAATGATCCATTGCTCATGCATGTCGCCGCCGGCC
GTGGCCAGCCTGTTATGGTGGCCACTGGCGGCCAGGATATCCGATATCTGCACCCACGCGCGATGGCCGACCACTGCAACGCGTTGCAGTGCGTTGCAGC
CGGCAAACGAGCCGAATCGACAGTTGAGGCGCGCAGGCGCGGTGCTCGCTTCAGACAAGGCGGCCGGCCGGGGGGGCAAGGATTTTGCGGGGACATGAGT
GCTGAAACGGCCCCCCCCGGTCTCGGCGACTCGAATGAAGGCTGCTTGCTGCTCTACCCTACCGGTAGGGTAGGTAGAAGCTGCCGGCATGCATTTATTT
CGCTGCTAGCGCGGAGCGATCTGCCGTGTCGGCAAAGACCCCTTCAGCCCCTGCAGCGCGCATAGGCCTCGCGTTGTGAATCTGCCCGCAGAAAAGTTAG
CTCGTTGTCGTGATTTGGCGTTCACAATCCCGCCCGCTGGGCGGGAGCTTCAATCTGCACAGCGCGCTCTGCTTCGTGGTCTCGCCACTTTCTGCCCGCG
ATGATTCGGCCTGCGGCTGCACGACGCACATCGCGGCGACGCATCTAATTCAACAAGCCTCGCCGTAGAGGCCGCTGCCGAGCAAGACTCGCCAAGCCAA
GTACAGCGGCATCCGATGGCCTCGCCAGCCGGCTTCGATCACCACCTTAGGCTCGGCAGCAACATGATCATGGGCCTGGGCACCTTTTCGTCAGACCCTT
TTCACCGCTTTGGCTCGGCTCACGCCGCTCCGGTCTGCCGCAACGCTCACAACCTCACGTCCACCGAGACCCGCACATTGCTCCTGCCAGTTGGTGCACA
TTTTGTAAGCAAGCGCTCGCCACCTGGGCGACGACGAACGCTGCGAGTGTCAGGACTGACGCATGGAACCGCATGGCCGCGACCGACTTCCGCTGGTCCA
GCTAAAGCCAGATCTAAATGAGCTCGTGAAGAAACCACTGCACCGCACTGCATGGCTCCTTTAACAGCACGCCAGCCTCGCTCAACTCGATGTCCAGAAA
TGGCACCCCCTCCCCACATCGCATGCTCAATGTTCGAGCCTCGAACATGACTGAAATTACTCGATACACCTTCGCGTCCATAGAGCACACTCTCTCGCTG
CAACCCAGGCTCACTTCAAGGCAGCTCTCGCCGATGGAAAGGCCTCGTGTCCGCGCACTGCGCGGCGCAGCTCTGCACCAGGTCCCTCGCGGCCTATCTT
TTGCCAGCAAGACGATCCCGCCTCGAACCGCACCAGAGTCTGCGTGTTTGCTTGGCCGCCTCTTGACTCGAGAGGCTTGAGCACGGCAACTTTCAAGACC
GACAAGAACCGGTGGATTCGGGAGTCTCGACGAGACCGTCGGTCACTTCAACCACGGCTGCCCAATGCGCTGCAGCTGAGACCGAGCAATCAAGCGCGGA
CCGTCGGATCCTCGCAAAATGAAGCCCGTCCGTGACTTCTTTGAACTTTCGGGACAACAATCGCCCAAGAGTGCCGCCTCGTCTTCCTGTCCACTGCTGT
GCGCAACACGATGCGCGCTGCGGGCCGCACTGCAGAGCGGCACTGCGGGTTGGCAGCAGCAACGCAGGTTGCTGCTTTCACGCACAACTTCGCGTTTGCA
CGAGCCGCGTCGACTGTTTAGACCAAGTACATATACGAAGCTCTGCCCGGTAATGAGCACGAGCAGCGCCTTAGAAATCGATTTGCAGGAAATGGAGCTC
AAGTCGATATTAATACATGTACTTGGATAAAAATATGTTCACTTCAAGAAAGCCACTTGGAACTTTATCAAATTTTGATTTGATTCAAAGCTCTCGTGGA
AGAGGACCAAGACTTTCGTGAAGCCCGTCAGGCTCATTTCGTCCTCGTCTCTTGTACAACACTACTCACTCATAGTACTCCGACTAAAAAGAGGTGAGTT
AAGCGGCAACGAGCTTTATCAAAACTTCCCACAAACATACTGGAGGCATATCTACCAATCATATCATAGATTATGTTTCAAGCAAACATGGCAACAAGAC
GGGAATGTACATGTATACATTTTCTAGGACATAATAAGACGTCAAAGGATTTGTATGGGTACTTCTTTCCCTGAAATAACGCCAAATAACATTTTGTTTC
AGCCAATCATATGAGAGATCAAGGTAAAGCTAAAGGCGCCTAAGATATTTAGTCCATTCTCCGTCCTCTAACCGAGAGTCCTGTCGGTGAGTTCGTCACG
CTTTACGAGCCTACAGCATAGACCTGTCATTTCGACTACGTTATCGCGGACCTAACAGATGCATTATTCACTCATCAAATCGACTCGCACTGGCTTTTAA
ACTATTTACGAAATTACAAAACTAGACACAATCACGCCAAAATTCGTACTTACGCGGAAGAAATCGGACTTTAACGGGTGTGATTATCCCATCCCCCATT
TTGAAAGTTGGCGCGCGGTGGGCGGACGGACGGAGGCAACGAGCGGGAGGGCGCTTGGCGTACCGGAGTAAGCAGCGGGCTGCAGCGGCAGCGGGCACTA
CCACAGTGAGTACATGCATACGTTTACATTAATAAACTACTTTACGGTTTCGGGAGTTCCGCCTGTTGGGATAACTGGTGCCTTCAGGGCAGTCGAGGGT
TTACAGTACGGAATTAGGGGTAGACTGGTGCTTATTAGGCGTTCATCTTCTAATACACCAAGAATGTGTGCGAACGGCGCATTTAGACCACCTAACGCTG
CACATAGATTAACTGATAAACAGCACGCGGCGTGGTGTTGCTGGCAATCGTGCTGTATTCATTTGCAGGAATCAAGCATTATAATACACCAATTTGAGTA
GTCGCGTGCTCAACTTAAGTTACTACTACGTAGTAGTTGGTCGAATTAAGTAAACCCAGGTGCATCACCAGCGCGCGCATCGAGGCGTCATACTTACGAC
TTTTTATGTTTTTTATTAAGCTGATTAATGGCAGGATCTTGCTGCAGTCCGACACTCGCTTCCATAGGAACGATAGTCGCATCAGCCAAGTGACAACAAT
GCACTCCAACTCAAATCAAAATCGAGCATATCCCAGGTACCCTGACTCTCGCGCTTCAACAAAACAATTTTAGAAAATGCTGCTCGAATTGCGCGCAGCG
CACAACAGCATGGTCGTGCGCAATTTCGAATTACTGTTACTAAGTACTGTACGCCATGCACCAAGAGCAATAACGCGTTATAAATCCAGATGAAAGATGC
AGAGTAGGCAAAGCGTAGAATAGTAGTGACACTGGCAACGCATGCAGCTTTCAAAATAAATGCGCGCTGCTACCCTAGATACGTGTACCGTAAACTACTG
CAGCATGCACATAATGCAGCTTAGTGTAGACATTGTCGTTAGAGCAATATATATATGAAGCTATTGGCCGGACCCCGGGGTCCCGCATCATGTACCGATG
GCGACCGGAATTATTTATTTTTATCGGCGGGGCAGTGATAATATATATGTTGTGACAATTTTGTGATAATTTTTCGAGTTTAGCTAGAGCTCATTTCACC
TTCAAGCATCTAGCATCCAGTATGAAGTCTAGGCGAACTGGAGGTGCAGAGGTTCCTCGGCGCAAACGTGATACTTAAGTATTGAAATCGTCGTGACCAC
AAAGCTGCTGCATTCGTTCGTTCTGTTAAGCGTCTTGGTGAAGATATGACCAAGAAGATTCAAGCTGACTGCTAGAAGCTAGCGCCTACTACAGCAGCAG
CGGCGTCAGGCACGCAAAGTTGCGAACTCTGCAGCTCTGTGCAACTCGATAGTCGATACTACCAGAGATACATAGCATCGATACAAACATGCAGCACTTG
AATTTACCGAATATACCGGTTGCTTATGACAGCTGGCGGGACAAGCGGGGACCCCGGGGTCCCGCTTCATATGCATATACACGATACACAACAACCTAAC
CATCGAAGACGCACAGTCGTTACCGATCCGTATTGAGTTGAGCTAAATTTACTATGTCTATTTGAACTGTTATCGCGCAAACCAGCATTACTACATGTAG
CGCGGTGCAGTGCGTAAATTCATGCTGGCAAAGTTGCAGTCTTTCAGTGCTAACGTAGTAACAACACTAGAGTACGGTATCGACGACAGCTACCAGTTTG
CAACGCTGTATAAACCACACCCAATCATAGTTTCAATACTTTAGTTATTACTTCAAAGTAAGTAAACACGCAGGTCACTACACTGTAGTAAGGCATGTCC
GTGACAATGTAGCTCGCCTCGCAGAAACGGGTGATCAATAATACAACGGCAACGATATTCAGCTCACTCGATGTTTAGGTACTCAACTTTGCATCGTGAG
CGACATTTGGTAATTAGCTTAATAGGAAAATGTATTCCTACTCATTTGCTACTAAAGCACGAAGTTATAGCAACGAATATGTGTCAACTGTATCCGCACA
TTATTGTTATGGAAATCAAAATGATGCATGTACTTTAAGCTATGCTATTCCAGCAACCCGTGGTCAAAGCGCCCGCGTAGCGGGTGCCCAGAGCGCTAGT
TCCCCTTCTCTTATAGCAGTTTCCGTGTCCGTCACGACCACAACGTGACAAAATTTTCATTGGACGAAAATACATTAAGTACGAACTTGAGGATGGCGCT
ACACTTTCCTTATGTTAACCGTTCTTTGGTTTGCCGTTTGTGGAGCTATCTGAGCTGTCTACTTAAACCTGTTGCCAAAGCTACAGCGACCAGAATACTG
CGACACTCTATACATATAGTAAAATTCACCAAGGTCCAACAGGTGACATGTAAACAACTCTAGAGTCGATGAATATTGTCCTATTCAATAGCTATGCCAC
CCGTGCGGCCAATGTAGGTTTATACCAGAAACAACTTTCCTCACTGTAAACTACGAGTTCATACCTAAAAACACCAGGAAATCATACCAAAAAATACGCG
TTCATACGAGTAAATACGAGATCGTACTCGTACATTTTGGTATGAACTCGTACTTTTCAGTATGACTAGTTGTTTTTGGTATGAAATCGATTTTGCTTTG
GTATGATTCACTTCGTAATTCGCCCAGATCAAAGAAAGTTTTGCTGATAATATTTAGTTTTAGAAAATTGTAATATTGGTACTGACATGCCCACCGAAAC
AACGTCTCAAGGCGGCCGAAAATCATTATATAGGGTTCGGGTCACTTCCATACAAGCTTCATGATAGTGCCTACGAGGGGCTACTATTGAGGTGTTATTT
CCGTCAGACCATGCAAAACCATTGAAAACACAAAATAGATTATCAAAGTTATATAATCCCCATCTTTATCGAGACACATCATTGTACCTAAAAATGATAC
AATTGGTAGACGTTCCTCAAGTAAGATCGTCCGGCGCATGAATGTGGTCGTATTCGCCTTGCACCACCGAATCCAGAGGAGGGTGACAGAAAATACAGCG
CTTTAGGCCAACACATATTGAGTTGAGGTAGTAGCATACCAGGTGGGGTTATGCCATACCCTTTACGTTAAATGAGGACAGACCATACTGGTAGGGTCAG
AATATATTCTCCGGTCCGCTGAATTGCACCCAGTGACGGTTTCATCAAACTCGCTTCACTACTACCTCTTGAATGATGAGGGCGCTTTTGCTATCCTATG
TTGTGCTGACTATCTATAGATGTACAACCTCTCCTGAAATCCATCATAACATCTCTAGCATCCGCTGCGAAAGTCGGCGAGCCGACGGGGGGAACAAGAA
ATGGAGTCATGACGTCAGCTCTCCGTTGAAGACTCAGAGGATAACTATGAGGGCTCCCGTAGGAGGGATGATAAACTTCCTTTTTCAGTTTTCTTATATC
TTCTTTTATCGAAAAAAAAGATTGTCGATTTTCTTCTTTTTTCTTAATTGTAGCCAATTTTCAACCGGTTAGTTGATATGAGGGGATACTAGAAACGAGC
CGTAACTACAGTACAATAGTTCATTTGTTGTCTATTCAAGGGATGTAGTAGTCACCTGATCAATCGAAGGCCACTCCAACAAAGTGACCACTACATCCTA
ATCATCACTCCATGTCCCATGTATTCAACGAAATGCCTGCTATACTTTTCAGGTATGCTGCCGACTCCGTCTGCGTCGATTATCTATTTCCAAAGTGAAG
GCAACAGTGTTAGTGTAGCGACGTCGACTTCAACGGCGAAGCAAGTAGACAAAGTGGTAGGGACCTCGGCTAGGTATATATGTAATTTGGGAACCGAAAA
TCTTCTTTTATCTTATTAGGGGTAGTCAATGTCCGTCACTTTTTTCCGCCGCAGCAAGTCGGATTTTTTTCCGGGGCTGTGATTGGTCAGAAAAAATCTG
CGATCGGAACGTTCTGGTCGAGCCGCAGCAGCAGCTCGTTTTTTTTTGCTGGCATGGCTAAGATCTGAGCACCAACGGTACGGCAGCATGATCATTGCGC
GACGGATAGACTCCGCACTTGGGGGCTGTGCCGCGAGCAGAATTCTTGTAAGGTCGATCTAGGAAGTCTACATGTGTCAGTCGACGACTTGGCGTGCAAG
CGTTTCTCCAGCACCATCATGTAATGCACGTTGTATGCCGAGTGACGGAGATAAGAAGAGCACTTCCACGCTCTTACTGAAGCTCTAGATCTACACTACT
CAAGTCTTCCCTAGCAGCTCAGGGCTGTATCAAAAGCTGCGTCCGCCGATGGCTGTGTGTTAGAAGGCGCTGAGAGTAGTGAGCAGACGGCAGTTAGCTA
AGGTAACAACAGCTAACTTAGCTCTACTTTCGCATCAGCAGCCTGAGCAACAAGCGCCTCCCCCCAACAAAACTCCCCACGTTCAGCCTCCACACCTTGA
TCATCAACAACAGGTGGGAGGGCGCGTTCAGCAACCTCTACAACCCGGACAGACGCTGACTGGAGTTTCCTGCTGAGATCAGCACTTACCACGTCGACTG
CAGCAGGATGGACACGCCGCTGCCTTCTCACACTCAACTTGAAGGAGGTAGAGGGCATCGCCTTCCTCTAGCTGGCGCTCCAGGCGTTCCAGCGCACGCT
TTCCCCGCATCCCAGAGGACAAGCACGTGGGCTGGACGTTTGATGCCGAGGGGTGACTGAAAATCTAGATCTGTTGCTGCAGACCGAGAATGGGGTGGTC
AACGCACTCAGCTTGTGATTGGCCAAAAACATTTGGCGCGTTCGAGCAAGAAAAAAAAATAGTTGCTGCTGCAGACATTGACTACCCCTATTATATTCTT
GAGAAAAAAACCTCATTTTTGATCATCTTTTTTTTGACATCCCGGTTCCGTGCTGAATCGATGCGTTGTATCGCTGTGGTTCTGAAGCGCGATTTCGATC
TGCCGTACGTGTGGTGGTCAGTATATAATGACAGAGCACCGCCTGCAGTGTAAAAGCAAATGTGTACTATCTGGAAAGCATTCACTTGTGGGTAAATGAA
CATGGTCGCAGACATGGTGTTATGCTCTGTGATGTCGACGTACTATTTCAGTCATGAAGTTGTTCTTCGCTGAGTGAGACGAAATCGGAATTCCTCCGCG
CCTCATTCTGGTGAATAGGAAGCGACACAGAACATCGGCTGCAGGCTCGACCCGTGCACTACCGACTCTAAAGTAAATTCGCAATGTGTTCAAACGCATT
CGACTCGATCAAGGCAGTAAAATTCGAGGGGTTCAATTCAACAGCTAGAGCGTCTTCGCTGTTATCAAAGTGTGATGAGCTTCAGTACAGCCGTTTTGTT
TGGAGCCAAGCTGGATGGAGAAGGATACGACTACGTCGGTATCGGGCCAGATGAAGACTCATTTATCCTTGGCATTTCGCCCTTGTCTACGATCGATGCC
TGCTTGCGCTTTTCAAAGAACTGCGCGTATTGCCAATTTCACGCCGATGCTACTTTCAAGGTTAATGACACTGGGTATCCCGTAATCACGTGCGGGTTTA
CAGACAAGGCGAGGGCGTACCAAGTGGGAGCATTCTTTGTCGTAAGTCGAAGGACAGTGCACGAATACACCGAGTGCTTTCGAGGCTTTGTGGGCTTCGT
ACTTGATCACCGAGGCGCTACCCCACAAGTCAGCGTCGTTATGGGGGATGCAGAAGATCCGCAGTATAGCGCTTTCGGGTCGTTACCAACCTTTTCCGGT
GCTAAGATGCTAATGTGCTTCTTCCACGTTTTAAAGAATATGCGAAAAGGAGTTCAGCATCTTCCAATCAAGGACAGGATGCAAGTCATGACGTCGATTG
TTGAGATGCTTCATGGAAGCGTATGAGACCATTCGAGATCAGGAGCTTGGAAAATGACCCAGCTCTCCTCGTTTGCTGACCATTTCGACGCACAATGGCT
CAAAGGTCAATACTCACAATGACAATCGTTCCCCACACCACATTTTGCTTGCTCAAACAATCCCTAAGAAAGCCTGAACGGACCTTTGAAATCACTTCTC
CAAAGACGTCGCCACCACATGCGCCGACTACTCTTAGAACTCTGCGAATTCATCGAGACTATAAGCCCGTTGATCCCAGTAAAGTCTGACTACAAGGCGA
TGTCTACGAGTGGTGTGGCCAAGGCTGCAGCTGAAATGCTTGAAGCCGGTCATGTGCAAATTGAAACGACCTCCGAAGCGGCTCGTGTCAGGGTTTTAGT
AATCTCGTACCGGA