Description :
From Genome Similarity Track
Location :
contig_47:19553- 20863
Transcript NameFunction/comments
g7800.t1hypothetical protein

Sequence
1310 bases(100 bases per row)
GCAGGCCCCATTCCTGTAGCGCAAGTGTGTTGCGGGAAATATTACTGCATGGCGTTGAGTCAAGCGGGAGATGTCTTCACCTGGGGTGAGGCGTCTGAAG
GTCAACTTGGCCACGGCGAGATGCATGAATTCTACCAAGTTGCACTCGCTGATCGGCACATGGTCAGCTCGGCGTACACGTACTTGGCACAGCCCGAGCC
GGTGCTGGCACTGTGCGACGTTCGAGTGACGCAAATTGCATGTCGAGGAAACCACTCCGTCGCTCTGAGTGCCGATCACGCGAACGCTAGGCTTTTTGAG
TGGGGTAACTGGGGCAGACGGCGTGGTGTGGACAGCGAGCACGCCTTCGTGCCTGAAGAAATGGCCGGAGCTTCCGCTCTGCGTCTCCGTCAGGTTGCAG
TCGGAGATCACCACATATTAGCGGAAGGAGCAAGTGTATGGCTTAAGCTGGTAACGCGCACGAATGGACCGGTCCAAGCTGCTGAGCACGGAGAGGAAGA
GACGGGATTCTTTGTGGAGCCACTGGCTGGTGCATCGAGCTCACTTGATGCTATCGAGCACGATTTCATGGGAGAAATCTCAACTTCGTGGGTCTGCTAC
CTTGTTGACCTGGACGCCGATGACGTTGACGAAGTCGAGAGTGCGAATAACGCTACCGATGAGCCATCGTCTCGACCTAGCACAGGCAAAGTCGATGGAG
CACTTTGGCAACGGCGAGCGGAGCGATTCGCTGTTAGCCTTGACCGACTGGCAGAATTCGACCCTCGTTCACTGCGTCTGCTGGTCAGTGCACCCGGAAG
TGCAACCGATGCTATCAACACCTACGCACAGGGAGTGGATCAGTGCTTACGTGGTCGCGTGGCAAACCGTCTTGTAGTCATGCCTCGAGGTAAATCCGCC
GGGTTCTACGTGCAGTTCCGCCTTCCTTTAGCTACGTCTAACAGTGCAGTGCTTGGACCGGAGACAAACAATGGGGACGCTCGAGCCGAGGAACCTGGTG
ATGATGATGATCCTAATAGCAGTGCTGCAGCTTCCGGTGTAGTGCTCGAGCTTGCAGTTTGTGGGTCTAACACCGCGAAGCAAGCAATCAGCCGACGCGG
ATTTGTTACACACGTATTTCATCCGGCCATGGAGGCCGCGGCCAAGCGGCTTAAGCAGCAACAACTTCGTGCACGTTCAGTAACGAAGAAAAGCCCACGG
TCGCACCCACGGAGATGAACAGCATTTTTGTGTTAGAGATTGATCAGAGTGTGCTTGCACCACTAGCTTCAGCCGTGACTGAGAACGATCCAAGCGCTTC
ACAAGAGCCC