Description :
From Genome Similarity Track
Location :
Scaffold_208:19552- 20654
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_208-fgenesh-gene-0.2Dicarboxylate/amino acid:cation

Sequence
1102 bases(100 bases per row)
TCCGCCTGGACCTCGGCCGTCGTCATCGCTCACTTTCGATCCGCCACCGCCGCCGCCATGCCGTGCTACCTGAGTGAGTGCGTGCCCGTGGATGAGGCCA
AGCGCTTCGCCACGGCGCTCGTTGGCATGTACGTCTACCACTTCGTCTGGGACAaGGCCATCATCACGCCGATCGCCAACTGGTTCGTGCGCTCGAACCG
GATCACCAAAGAGAAGCGCGACAAGATGCGCGAGTCGCTTTGGAAGAACGCGGCCGTTGGCACGTTCACGTGCCTTGGACTCTACATTGGTCATGACCAG
GACTGGTGGATGAACCCGATGGGCTACTTCGCCGACTGGCCGCACGAAACGCCTGAGATTCTGCGCTGGCACTACATGATCTACCTGGCGTTCTGGTTCC
AGTCCATTGACTTCATGCTCAACATCACCAACAAGCACTACGTCGTCAAGCGCAAGGACAACGCGGAGATGCTGCTCCACCACTTTGCCACGATCACGCT
CATGGTCTTCTCGTACcTTTTCGACCTCACGCGTGTCGGCATGTGTGTTCTCATGATTCACGAGGTCAATGATCTGCTACTTGAGACTGGTACGTTTCCG
CTTCTGAATCGGAATTGTTGTTGTCAtGTTCTTATAGATTGACTGTGCGTAGCCAAGGTGTTTGTGTATCTCGAGTCGGAGCTGTTGGCGAACATCTTCT
TCGGCACcTTCGCGCTTGTGTGGTTCATCGTGCGCTGGGGCTTCTTCGGCTACAACATTCTGTACTCCGTGTACACAGTCgCGTATGAGCAGATCATCGT
GCCGATTCAGCAGAAGGGTTCGTTCGCTGGCTTCGAGGCCAACACTTGGTGGTGGTTCTGGgTCGTCTTCTTCGCTTtCCTGGGCATCCTcTTCCTGCTC
CACATCTTCTGGGgCGTGCTGATCGTCAAGATGGTCGCCAAGACGCTTCAGGACGGCAACGTCGAGAAGGATATCCGCAGTGACTCGGAAGCTGAGGATG
AGAAGGACAACGATGAGAAGGATGCCAAGCCTGTGGCTTCGACCACGGCTCCAAGTGACGGTAAGGCCAAGCGCCGCCGTGCGCCAAAGGCCGAGTAGAC
AG