Description :
From Genome Similarity Track
Location :
Scaffold_67:195472- 197782
Sequence
2310 bases(100 bases per row)
ATCCACCCCCACTGGAGATCGGTCGAGCATTGGAGGGAGGCGGGGGTGTTGGAGAAGGACCGCATAATGCGGCGAAAAGCCAGTGGACGCCTGAACCGAG
GAGTTGTAAGCGAAAACCGCATGTTGTAACGTGACAGCCCACGAGGAACCGGTAGAAACGGAGTAGTCCGAAGGATATCTTCGAGGACGCGGTTGGCGCG
TTCCGTTTGGCCGTCGGACTCACTTCGCCGTGAACCGCGGGTCGCGGTCCGAAACGATGGAGCGAGGCAGGCCGAAGCGACAGAAAACGTGGTCGAATAA
GAGGCGAGTTGCGTCCGCGCCGCTCAGCGTGTCTCGAACGGGGACGGCAATAACGTATTTGGACGCGCGGTCGACACAAACCATAATGCCGGTGTTGTCG
CGGGCGTCGCGTGGCAGGCTAAGCATAAAATCCATGCTGACAGACGACTAAAGTTCGTCGGGAATAGGCAGAGTTGGAGCGGTGATTTTAGTGCGCTGGC
AAGCGTCGCAGTGAGCGACGTAGCGCACAACGGATTTGTACAGTACATGCGAGGCCACCAGTACGAACGCGCCAGGACCGCATGCATTTTGTCGCGGCCA
AAATGGCCGCCACTATGGTAGTCATGGTACGATCGAAGGAGAGTGAGGCGCAGCTGCGCGTCACCGGGCACAACGATGCGCGGGGGCGAGTCCGCGATGG
GTTGGAACATCAAAAGCCCGTCGGCGAGGGCAAATCGATGTAAGGCCGACGAAGCGCGGCGGGGTTTGGGGGAAACGGGGTCGGTGAGCGCCGCCAGGCG
CGACGAGCAGTCAGCGTCAAAGGTGTACGCCGCACGAATTCGATCGTGAAGGCCCGACGTCAAAAGACCGATCGTGGTCAGCTCGAGATCCGGAGGCCGC
AACAGGGCGTCGGCCAGGATGTTATCCTTCCCTGGCTTGTACTGAACCGAAAAGGTGAATTCGGAGAAGAACTTAATCCAGCGCGCCATGCGCTGCGAAA
GGTGCGGTGTGTTCGTCGCCGTGCGTAAGGATGCATGATCGGTGTAAACCACGAAGGGTTTACCGCCGAGGAGGTAGATGCGGAACTTGGTTAGGGCGTA
CTTCATGGAGAGAAGTTCCAAGTCGTGGACTGGGTACGCCCGCTCAGCCGCGTGAAGTTGGCGGCTTTGGTAGAAACCGGGCGAGGGCGACCGGAGGCGT
CGAGCTGCATCAGGCAGCAGCCAACTGCAAACTGCGAGGCGTCGCAGACGACTGAAAAAGGTTTGTCGAAGTCCGGGAAGATCAGGGCGCGTTGAAGGTT
GGTTTTGAGGCCGTCGAAAGCCTCCTGACAAGCGGAATCCCAAACCCAAGGGGCGTCGTTGAGGAGATGCCGAAACTACGGCTGGGCGATGTCCGCAAAG
TTTTGCGAGTATTTGTGGAGGTACGTCGCAAGGCCCAGCCAGCGACGAAGATCCTTGACGGAGGAGGGAATAGGCCACTCCGAAATGGCCTTGATCTTTT
CGGGATCAGCCCGACATCCGTTCACCCTCACCAAATCTCCCAGGACCGGGATTTCGTCGACGCCAAACATGCATTTGGCGAGGTTGGCATATAGTCCGTT
GGCACGGAGGACTTCAAACACCTCGCGGAGGTGGCCGCGGTGAACGTCAAGATCAGACTGCGCGGATGAAGCGCAACTGTGATCGTAAATGTCGTCGATG
TAGGACGGGGCGAAGTCGCGAAACGCGCGGAACTTCGCGGTAACCATGCTGTTGAACGTCGCCGGGGCATTGGATTGACCCTGTGGCATGACCAGCCACT
CCCATAACATGCCACTCGGCGTAGAAACTGCCGTTTTAGGGGCGTCACATAGACGCATCAAGATCTGGTAAAAGCCATCGCGGAGGTCGATGGTGGAGAA
AATGGTAGATCCACCCATGCCGTCGATAATAACGTCCTTGCGAGGAATCGGCGTCTGAGCCGGAATCGTGGCTGCGTTCAATTTGTTAAAGGCGTGTACA
ATACGCCATTTCCCGCCGGGCTTCTTCACACCGAAGGTCGGACTGCTGTGAGGGGAAATGCTCTCGCGGACGTGACCCGCCGCCTTGCGGGCCGCGAAGA
ATGCGTCAATGGCATCGACTTGGTCGCGAGGCAGCGGTCATTACCGCGTGACACAATACTTAGCACCGGGCACGAGGTCAATCTCGTGTTGAACGCCCTT
GTCGACTGGGAGTCGACACGGCACCTCGTCGGGGAAGACGTCCTCAAATTCTTTGAGGAGGCCGTAATAGGGGTTGGATCGCAGAGAGTCCCACGTCTGG
AGCGGCGAGG