Description :
From Genome Similarity Track
Location :
Scaffold_21:19542- 26071
Transcript NameFunction/comments
Phyke_g1348hypothetical protein
Phyke_g1349conserved hypothetical protein

Sequence
6529 bases(100 bases per row)
GACCAACAGATAATATACACACGGACGCTGCTTCGCGACGTAATCGAATCTATGAGTACCGGAAACAGCAGTTGACGGACAGCATCAACGTGCACCGGTG
GTGGCCGCTGGTACGGACATTGTGATGGCGGCGTCGGGTTCATTGACGTGACAAATCGACTTTCGGCTCCTCAAGCGTCCGACTGCTTTCTGGGCTTCTT
GCCGAAGCCACTCAAGAATTTCATATTCGCGCTAAACTTTTTGGTGAGCGAGCTTTTCTGCAGCGAATCAGCGCCATTCAGTACGGCCGCCTTGAAGCTC
TCGGTAACGTCGGGcgcacagctgcaggactCTAACTTTttctcaatctccaccaAGTTTTTCTCCGAAATAGACCGGATGACCACCAAATCCTCAATCA
ACTTTGACGAAGGCACGTGCGAGTAGATCTTACGACTGTCCGACGAAAAGCACTCGTCAATGTCTTGGCTGGGCGACATGGCCAAGTTGGCGAAGAGCTG
TTGGATTGCCGGGGAGTTTTTTTCAATGAATGGGTTGAGCACtctgcaagagcaagaaattgATGGTGAGTATAACTGAACAGCGACGCGTATTCTCAAT
TCGCCACACGTACTTAAATTGAGGCTCTCGGTCACCAAATTTCACACCCGTCGCCGTTTTGAACAACAGCTTTGTGACGAGCACAAGCACTCGTCGAGTC
TCAGGTGGAGGAAGCTGCTTTGTAAGGCCGTACAAGTGTGGAGTGGTGATGGCCGGACACACAAAgcggaggaagaggaagccgCCGATCACCGACTAGT
TGCAAGTGTAAACAAGTACCACCGAGTCAGTCcccaagaaaaacaacaCGTGAACACGAGCGACGTACCCGAGTGAGCGTGGATGCGTCCTCTGCTTCAA
CACCTTCCTTTGATCCGTCAAAGCGACTGATAACCTTAGAATTCAGGTGAGAGCATATGTGGAAATAGGATGACGGAATCTGTAGTGAAGGTAATACAAG
ATTAGTCCCCAGATAgcagaaaaagaaaagcaTCACAGCACGTACGTAGTTGGTGTTCTTCATGATCGAGTCAATAATGTTCTGGCATGTCCGCATCAGG
TTTTCGGCATTGGCATTAGCTTGAGCCTCATCCTGCAGTGACTCCTCCTTATGCGGGTTCAGCTCCATATCAGCAATTTTCAGCTTAAATATCTGGTGAA
TAGGGTCCGAGAGAGCCACTCGAATAAACTTGGAGCCGATAGCCTTGCTGTATGTGGACACTAATCTGCTGGCATAGTCGTCCGAACGGAAGAGTGTAGC
CACATTGATGACAGACGCGACTTCAATCTCAATTGCCCAACGGATGAGATGGCTCAGGCGGTTACGACTTCCGAAAACTCGAAGGAATGGAcctagcagc
agcatcttaTCGTCTCGTCCAGCACTCTGAAGGATTGATGCCACTACTGACATTGTGTCTTCAACTACCAGGGACGGAAGATCCCTAGGTGCTGCCGGTG
GGGGCACTCGAACTGACACCTCGAAATCGCCATTGAGAAAATCGCGCGCAGATCTTGCGTGAGAGAATAGAGTGCGTATCCTAGGGCTTGGGCCGTTAGC
AGAGCCTGTTGCAGGTGACCCTGATCGTAGAGCACGCTGCCGATGAGCCTCGTCGAGGTCATCAATTTCTTTTGGCGATTTGGAGCCAATTCCTTGTTGA
ATCTCGGCAATGATTTCATCACTGATAATCAGCCGGTCTGGCTGACTCGGTTGTTCGGGCTGTGCGGATACGATAAAATCTTTCATGACCTGATGTATCG
AATCCAAGAAGCCACTTGCCTCCAAAAACTGACTGTCCGACTGCAGTACGAGAACACACAAGAGCAAATGTCAGCAACGTTTGAAAATAATtttaaaaaa
acacacaaGTAAACCAACTTACAGCATCAAACTCCGACAAACGCTCGATGTCGccgtcctcatcttcatcgaaGTAAAGGTCGTCTTGAGTAATAGAGAA
AATGCTATCATTGCTGTCGTTAGAGTTGATTTGATGGAGACCAAAATCTGTTACATCTGTCAAGAAGACGAACACATATTAGGATGTCAGCACaacccaa
gcagctcgagcacCTGGAGCAAAAGCATACCTGAAAACGATGACTGAGATTCATTGAggagtgatgacgacgaacttGACGCGCTTTTTAAAACCTTCTG
ACCCGACTAAACGCATAGTCGAACACAGGTAATGTTAGTAAAAAAAACTCACTGAGTGCTGTATTGCTGGTGAATAGAGAGAAACGTACCTTTGGTGGCT
TCGGATCTACTCGGAACGAAGATTGCAGGTTGCGCGCTATCTCCGCAAGCTCCATTGCCTGCTGTTGCAGGAAGTCACTACCGGCGCTGCCACTCCCATC
GAAAATTCCCAGTCCACTTTGTGTTCCCTTGAAGCTGGATGTAAGTGAACCATCGTCACTGCTTTCTCGTGTAGAAGATGAGTCTGTAAGGTCTTCTTTG
TTCAAATTGCGCGCCATCTCTGCcagttctgctgcttgttgctggattGAATCGTTCTCCGCAGCGTCATTCAAGTTCACAGACTTCGAGCTCAATTGTG
AGGATGGCGATGCCACGGGTGCCACGTATTTCTCGGACGATAATGGTGCGGATTCTTGCTTAGGTGACTTTGGCGTAGGCTCATGGTTGGGCGTTACGGA
CACTACCACAGACTCTTTCTTCGCTAATACTGGCACGACCACGTATTCTTGCGTTGACGAGTCTGGCACTGACACAGAGTCCTGCTTCAGCGATTCTGCT
ATTGACCCGTTCCTTTGCATTGGTAATGCAATTATAGGTATCTCATCAACAGCCGACATGGTGTTCACCTTCTCAACATCTGTTTCGAGTCCGTCAGATA
CGGTATTCCGTCTTTCTTGGCTGTTATCCATCTGTGTCTCCTCATCCACTGGAGTCCCAACGCTAATCTCGTCGTCATTTTCTTTCTGAACctgttcgcc
ttcttcttcatcatcagtCTCCTGcgtgtcatcgtcctccGACAACGCTTCCGAAATGCCCGAGTCCCGAGATATCTTGTTCAGTACAATCAAAGGCTCA
TTGACCTCGACTTCCTGTAGTCcctgtgcttcttgttctgcCTCTTGAATCTCATCTCGTTTCCTCTTTTCCACCATCTCCAAACGTTTCTTAAGATGTT
CAATCTCCtctttctgcttctccacaacCTGCAACGCATCCTTCAACATCTCCGACGTGTCGTTATTATCCTCCGTTGTGCATCTCCGTCTCGCATAATG
ACTACGTGGCGACGGTGCTTGGGAGTGGAAACTCACAGCCGACGTCGCAGAATTCACCGACGTCGAACTCGATGATCTCGACAATCTCCTGGCCAGTGCA
AGAGCTGCCTTGCCGTCAATACTCCCTCTTCTCAGTCCAAAAGTGTCCATCGCTTCCCCTGTGGCTTGACGCAGTGTTTCAATCCACTCCAATCGTGCCT
CATGGGACGGAGAGCGGAACAGCAAGACCCgcccgctgctgctcgtgacCTTCCAGCAAGGTCCACAGTCGTCGCCTGCGCTCGCGGCGTCTCCATGACG
GAAGATGCGGTCCACAGACTTTACATCGGCGCCAGTGAGGGGCACGACGCCTCTGGGCCAGTCCCCTAGATTTGCGTAATAGAATAGTGTACGGGCGTAG
ATCCCCACAAAGAATGGTTCCCAGGGGGACTCAAAGCGTCTTCCTTTCTTGTGAAGAATGCGCAGTGTAGTGCGTCGTTCCAGCTCCACGCCTCGCAGTA
GGAATTCGGGGCACTTGATGAGTTCTGGGTGTGCTTCCTGGTCCTCTGGTATCTGTACGGAAAGCCTCGATGCCCCTAGACTGGAGacgcgactgctgct
tggatCGAATACAGAAGCTCGTATTGACATGACCACCTACTACAGCCAAGGCTCTAATTGTGGAGTGATCGGGTCACAGTGCAGAGGGATGTTAGGAAAA
GGCAAGTTGGGCGCGGTGTTAGGGCAGCGAACCGGTGCGAGGCAAATGTATGAGTTTCAGTATGAACGATGGACGCCCGGTGCTGTTCACTTGAAACGTC
GGTTTGTATCAGAGACAGCAGACAGGCCACTGCGAGAGAGGACGACGGGGCGTCCGTCAGAATAcatagtgaaaccaagtgaatTTCTCTAATGCGGGAT
AGACACGCTAACATGAACATCGCCGATGAAAGACCGCCATGGCTAGGAGGCGAACACAAGGGTCGAAGCAGCGCTTGACAAGCACTCGACCATCAACGGC
AACAAAAGTTAAATGTGTATAACGGCCTTCATGAACCATGCTTGCTAGCTATGCTTGTAGACTGTTCTTCAATCAGAGCGAAACCCTCGTTGTTGTGGAC
GCCGTAGGTACAACTACAATTTCTAGCACACTGGAACTCTGGCTTTTTTTACTTGAAGCCGCTCTCGGTGCGGTCGCCGGTCGGCGCGAAGGCGGAACGC
GTGGCGGAGCGCGTACTATAGCTGGTTTTTGGTCATCATGTCGCTGCCCTCACGTCTACCACCGTACACTTTAGACAAGTGCCGATGCTGTCCGCACAGT
GTAAGGGCGGAAAATCGTGTTCAGCACAGTGCGCTCCTACCTTTCCACATCCCAAGCACTTGTGTCTTTCCAATTCCCGAAATCACAATATATGGGCAAC
GTTCGTTCACTTGGCGCTTCTCGGAAAAAGTTCAGGGATGCAATGGAAGCCAGAGAACGGAGCTCCTCGCAGCGTCTCCTTCCAAAAAAAAAGCAAAGCT
TTCGTGCAGTGTTCGAAACTAAATTCACCAGTTTGCATCACGACATCGGCGCATATGCGTGAGGTGCCGACATGCATATTATGAGGTGTCGACATGCATA
CCAGGAATGTCATCTCTTTGGGGCCGTCCGCACACTTCACGAGGTAGCTTGCCTTTCGGTGGAGTCATCAACAAACTGTCTCCAAGCAAATCCGATTACC
GTGACGTCCGACCGACAGCAGTGTCGTCACGGTGACAGCGGGCGTCCAACGAAGTCTGTCGTGCTTGTGGGATCTCGTCGGTGGTCGTCGTGCACGCACG
TTGATTTCCGCCCCTTAAGTCAGCAAATTGGAAATGCGCTGAGCCGCAAACGTCGATCCCAGAAATGGCTGGATGACCGTAACAAACAACTCGGCTTGAA
GACTGCAGCCTCTTTCAGTTTGTGAGACCACAATCTGTGGCTGCAATACTTCTGACTTATCGCCATGGTTGTGGCCACAGGTCTGTGGAATAACGAACAG
TAATTCATCTGGCCTGATGGAGCGAACGGAGTCCACCCACGACTTGCTCTCCTATATGCACATTACGACAGAACGAACCattgttgttgaagtttcCTTT
GACGTGGACCACACGTATGACCTTTACAACTGACTATGACATAGTGCAATTCAATTGCCCGAACCGTAACCGTGATTTAACCGTGTTTTAACCGCTCATG
ATCAGAGCCTGTGGCCTCGAGTGGCGCGCTCTCGTCCATTCGGCCCTTTGATCAGCCCacaagcaaaagcagcatctTTCTCCCGTCTCGCTCGGTAGCC
ATGGTACGTTCTCGATTGCTTGCTCTCGTTCTGCTCTCGGGAGATGGTTACAGCGGCCGGTAAAAGGAGAATGCAACGAGAAAGGGGGGAACACCCCCAG
CTGTGACAAACGTCCGTGTGATTGCCGCACGCGCGATCTTTGAGCGTTCAGTCCCGGGTCCGGTCTCCTTTCCCCCTTCAACCTCTAGACAGCTTCAATT
CGCCCTTGTATCCGTCTCCCTCCTTGATCTTTATAGGAACCATTTGTTTAACAGAACAGATTAACTGACTGGACGGTGGACTTACACAGGCAGCTAAGAA
CCAGAACATCTTCGCCCTCCTCGACTCGGACGATGAGGACACGCCTCgtgtgaacaagaaggcgaCGCCCCCGCCGTCGGCCCCTGTGGCGCTGAACAAG
CCCGCCGctggcaacaagaagaccaccaagaagccgGCCTctggcgacaagaaggagtCGCGTGGCCCGCGTGAAGGTGGCCGTGGCGAGAGCCGCCCGC
GTGAGCGTGGCGACCGTGGCCGTGGCGACCGTGGCCGTGGACCTCGTCGTGAGTACGAGCGCCGCAGCGGCACGGGCCGTGGCAAGGAGACCAGCAAGCA
GGGCGGTGGTGCCCGCAACTGGGGAAACAAGGCTGACCCCAGCGAGCAGCTGGCTGAGGCTGCTGTCCAGGATGGCGCCAAGGTCTCGGACGAGGAGGCC
GCTGTCGAGGAGCCTGCcgtcgaggaggaggaacaggAGGTGCAGTACACGCTTGACGAGTAcctcgccaagaaggagtcGTCGCGCTCGGGCGAGATCT
TTGCCAAGGTGGAGGTCCGCCAGGTGGCCAACGAGTTCTCCAACGCGGTGCAAATCACCAAGGAGGGCAAGACCCCCGACTTCATGGACTCGCAGTACGA
GAAGGTGTACAGCAAGAAGACCTCGGGAC