Description :
From Genome Similarity Track
Location :
Scaffold_161:1954- 25161
Transcript NameFunction/comments
g17559.t1hypothetical protein
g17560.t1KUF84422.1 hypothetical protein AM587_10008305 [Phytophthora nicotianae
g17561.t1hypothetical protein
g17562.t1RAW35323.1 Tetratricopeptide repeat protein [Phytophthora cactorum
g17563.t1hypothetical protein
g17564.t1XP_008894439.1 TTK protein kinase [Phytophthora parasitica INRA-310

Sequence
23207 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTCCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGC
GACTTGAACCATCTGCAATCGTCGTTCACTGCGCCGAGTCCGCAGATAATCATAAAGTAGCCCGCCACATGATAAATTTGAGGCAGGCTCCCACGTGGGC
TCATCATACCCAATCCACTTCACCTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATT
CGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTT
CGGTCGGTCTCCAAATTCGTCGACGGCCTTGAGTCGGGACACGTGCACCACCGGGTAGAACCTGTACCCACTTCGGTCTGGCAATTCCAACTCGTACGCA
AACTCTTCGATCTTTTTCTTGATCCTGAATGGTCCATGCCATCGGTGGGCGAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTC
TGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGGTCAGACGTTGCCCCCGTCTCCACCTGTGATCGTCAGAAGTCTCGTTGTCATCGACA
TTCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCCTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACG
AGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGA
TTGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCC
CAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCA
GGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTCC
GAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTGGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGG
AACAGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGTTCTGCTAAGACATTTCCTG
GCGAATAGCCTCGGAACTGTGGTCGACTTTTACTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAATA
GTCTGATTTGACTCGGTGGTACGTTCGGCCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGGC
ACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTTCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACGAACTTGT
CGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTTAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCGTCCTG
GGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCTACCTCGTTGCTCGATTGCTCG
GTTCTCAGCTCGCTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCCTTCGGCTCTATCACCGACGTTTCATCTGCAAACTGGA
CTCGTTTCTTCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTCC
ACGGGCTACTTGGGCTCGGGCGAAGATGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAACTCG
ACCAATTCTAATTTTCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCGGA
CCACGTGCAAGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGGTTCAGTTGAACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAG
GGACTGCTGGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTTGTTCATGCCAGCATACTCA
GCGAGGTTTATCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGCTAATGTCCACAAAATCCACGAGCAACTGCCATATCCAC
CGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGT
AGGTGACCCTTTCGTCGGCGGTGTAACTGGGGCTAACGAGTCTTCCAATTCTACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTACAATCG
CGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTAGATTTGTGCACCCATTCGA
GCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCCGG
GTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCAC
TCATTCGCGAATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCGGCGAAGCTTCGTT
TGGCTGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAATA
ATTCAGCGCACCGAGGAAAGACTGCATCCCCTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCT
GCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGTC
GGTCTAGCGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATGTCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGATTCATC
CGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCGTTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCCTCGAATTTGGTC
AACCGAGTTGTTGACTCCTCGAGTCGTCGCGATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGCTCCGAGA
AGTGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCAAACGGCATACG
AAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATTGTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGTGAG
CAGAACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCTTGTAGTCGA
TGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAACGCCACTAGACGAGCTTTCAGCAAGCC
TTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCACACCACA
CCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGACGGGCTGTCGCGC
TCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCAACTC
GATCTCATTCGCTAAATGTTCGGACGTATTGGTATCGGTGTTCCCACTACCTGAACCGTCCCCCGCGGCAATCTCATGCATCATTGCTACGAAGGCAGAG
TCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTTCTCTTCACTCGTATACGTTGTATCCGCGCCATCAGAGGTGTCGGTCGCCACCGAGT
CGTCATCTTCGTCGACCCATCTATCTCCAACGGGTTCGTCAGAGGGTTGCACCGAAGTCGTCAACGGCGTTCGGTCTCGTTCTGCCGGTTCCTCAGTGCC
CCTATTCGCGAACGTTATCTGGCCCTCGTCTAGGCCTTCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGTGTCGGATAGTCTCGTCGTTCTACA
GCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACTCCT
CATACTTGGCGGAGTTCAAACGAGTGTATCCATCCCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAAT
CTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCACACGTCG
TGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCAACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATGC
TGTACGGCTCAGCCTCTGCTGGGTTCTGCGACTTCACCAAGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCC
GGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTCCACTCCTGCACTGTGATCCATAACCCATACTTCAAATTCGTACACGCGCTCCCAGCCTAGCGTG
ACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGGTCTGGAACTTCGCGCAAGCGCAACC
GTTTCGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAA
TCGCTTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATT
TTGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGTCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCCT
TTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTT
GGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGA
GGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCTT
AAAGCAGTAGTGAGCCGAATGGGTGAGTCCTCCGCAGGCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCATCT
CGGTCATACGGCCGCTGACCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGTGTCGTTTGAAG
CAGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGTCCGTAATC
CTCGGTGTCATCATATCCGCCGTTGTACGTTTCTGGGTAACCTCCACGCACGTCTGCCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGCG
TCAGTGAGAGTGACCCTCGGTCGATACTGTTGGTCATCCCGGCGACGATTCTCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGTC
GGTCTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCATCGCGTCGGCGTGCTACCTTTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCC
AGATTTTCGCTCTCTGCGACGAAGAATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCGG
TCTTCGCACGAATCCAAGAAATGCTCGACGTGGTCTTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTAAGTCGGT
TGAGGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTTAATGAACGC
GTCGCTCAACAATTTCCACGTGCGCCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCAT
TCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTAA
TGTTGCCGAGTGGGAGATGCGTAGCGATCTCTAGCCTCGGTGTCGCACTGTCATTCCCCACAGCGCTCAGCTCACGAATTTGGCGTGCCCATTCTCCCGT
CAAGTCACCCCCGGTGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCATCGCGGAGGTCGTAACGTCGGCTGGGCGTCCGATTTGCACTTCGTCCA
GCAGTCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCAGTCGTTCCGTGCGACTGACCGACCTCGGCGTCACCATGTGAGAGTCTTGGAAATATGTCG
ACGTCGCACCTTGGGCTGAAAATATTCCGGCCTCGGTCGACCCTCTGGGGCGTCTCCCAGGGGTCACTGGCAACGGAATCATGGACGGGTCGATCGGATC
CGATGCGTGGCGGACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGCG
TCCTCGGGTGCCCATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCC
GAGTGTTCCACGCCTCCACGGGCACAGTTAACTCGCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAATTGCT
CTTCACCTTCATGAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCCGCCATTCGGCCGAGAATTCGCA
TCCTCGGCCATCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGGTGGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAGGT
TTCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATAGCTGCCTTCTCTTCCAGGTCATCTTCTTC
GTCATCTTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGAACCG
GAACGCCCCGAACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTCTTCT
TTCTTCTCTCGAATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGA
ACACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCA
GGAACGATCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCT
AGAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGGTACCGGCAGTCACGCCTAATACGGGTTTGCCGAGGGTAACCTCGGC
GGGTAGTGAAATACACTTGGGAACACTCGGGCTCCTCCAATATATAGGGACCGACACTCTCCGTCGTCCCTAACTCTCGGCCACTCCTATCTCTTGGACT
GACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTA
CCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTA
GTCCTATATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGACACGAAATGGGTACAA
ACGAGGCTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTGTTCCTAGGTCACTATAGCGCGGGAAATGAGACCCGCCAA
TCAAGACGCTCTGTCGCCGTTCACTGAAAGGTGCAACGTCAGCCAAACCGTGACAGTTCGGCACCAAAACCCAACGCCACACATTCAAGTTCCGCGCCCT
CGACGCGTGCCGTGGCTGACTAAATCAGCCTGATTGTATGGGCGTACTCAACTGCGTTTCCTTCCTGAACGACAGTCATATCACCAGCTACTCATCTAAG
CCAGTGCTGACATTCGGCGCCTCAAGCTTGAGCGGGAGCTGGATCAGCAGATGTTGACGTCGTTGGAGAAGTACCTTCTATCGCATTTTCAAGCTGATGC
AGCGAGTCATCAACATTGGCAACCTCGGCGAGATTGTTGCGCGTATTTGTCTGTTATTGGCGATGGACGCAACTATTATGTGTGGATTTGGACGCGGACA
GTCGAAAGGAGATTTCGTTTTCGCAGGGCAGTTCTGCACAGTCAGAAACTTCCTTGACATTTGTGTGGTAAGAAACTACAAGCTGGAAAACGTCCCGGAG
AAGGTGAGTGATGGATGGAGAGGTGGAAAGACTTGAAAATAGGTTTTAGCCGAATATGAAGACCTGTCCGAGGAGCCTACGGAGGAGATTTTATGGTTGT
TACTGCGTCGCCGCGCTGCTGGAGTACATCACGGATTGCGCTTGGTGATTCCGATCTTTTCCGGTGGTCTCGTTTGTTTTGGTTCAAATGGAAAACTAAG
TGAAGGAAAATGATTTTCCATCCTCGGTACTTTACAACCTTCGTGCTTCGAACGTATTCAAGGAGACAAATTCACTCAGCTTCGCGATATGGTACCGGTT
TACACTAGTCTGGGCGAGAAGACGAGCTATACGATGCCTGCGCATATGTATATGGTGGATACTACGGTTTTGCCCACAAACAAAAAGAAAAGGAAGAAGA
GGAAGAAATCGTCAGGACTTCCCGGATATACGTTGTACCTGAGAGGCACATGCCAACCTTCGCAAGAACCTGGTAATAGAACTAAAGTATATTCATTTCT
ACCGTCTGCGGCGTCGAGTTTCCTTGAGAAGATTGCCAACTCAGCCTGGTGGGACATCGAGGCGTGAGTTAATTAAGAGTGATTTTGACAGGTGGGACAA
CACCAAGTTCGGCAGACAAGCTGGCATTTTGCCCCAGCGCGAGTTGTTGGGGAATTTGAGTGACACGATCACAAGTTAAACGACGAAGAAGGGTTAAGAA
GTGATCTTGTACGGGATCATTACGGAGTAGCAGGAGGCCTTGGTACGTCGTGGCGAATCATCCAATGGCAAAAGCGCTTTCACCTGGTCGGACGTAGCTA
CCGTCTGCAGCTACAGTGCTCATGGGAGTTAGTGTCCGATGAAAAATAGCGTCCACTTAAAAGTAGTGTATAGGACACTAATTCTAATATTTGGGCATTA
GGAAACCATTTCCAAAAATACTGTCCATCTAAAAGTAGTGTCGTGCAAAACATCTATCTTAAAAAAGCGATCGGCAGGACGGCACTCCACGAAAATGGCC
GCGCTCTCTCCATGCGGTGGATGCGGCGAGCTCGTCGGGAATGTGCACGTCTGTCCCGTATGCCAGATCAGTATGCACACGTGGTGCGGTACGCCAGAAG
GCCCTGAAGGGTTTGGCCAGAAGATAATGTGCCCAAAGTGTCTCGCGCACGAGCGGCCCGTGAGTATCACGTCAGCTTCGCCGATTATCGCAGCCTTCGA
CACGATGGCTCGTCAAGCCACGACAAGCAATGGTGCCGCAGTCAAATCCACGGTCACTGGAAACAACATTGGAACCACCAACTCTGGTGAAGATGGTGCC
AGTGCTGTCATAACGGCGGAACACGGTCGTACTGTCGTCATTTTCGGCACGAAGCGCAAGCGCCAAGATGTCTCAACTGTGTCCAAGCGTCGTGCAGTTG
TGATGTGGATGCAAGAACAGCATGAACTCGGTGAGACGGCGCTCGCCAAAGCTGCGGTTGACCATTTTCCAGAGGTTTTCAAGAATGAGAAGAGTCGAGA
CTCCGATCGGAAAAAGGCGTCGAGATGGTGGGCTGAGCGTGGAACGCTGACTGATCTCCCGCGGGGGTCTCGTACCGTGTCGAAGGTCACGCCCGACGGG
CGGAAGGTCCTTGAAGTGAAGGCGTTGCCAGGACGCGGGCGTCCTCAGAGTGAGGCTCTATCCAGAGCTGCTGTCGGAGTTTACACGTCTACGGAAGGCT
GGGCTTCAGTTTGACATGCCCCTTCTCCGTCAACTTGCAATCCGTACAGTCGAACAGGCAACTGGCAAGTTCAACAAGCAAAGCCGCGACCACAAAGGCG
TGACGATCATCGAGAGGCTGACAAACTCTTGGATCCAGTATTTTATGGAAAAACACGGTATTGTACTCAGGTCACAAACGGGGAAGAAACAAGTATCGGA
GAAAAAGACAAAAGAAATCCGAGCATCCGTGGCGAGGCACCTCGGTCGTCTACAGCGTGGCTTCCTCAGTGGCGACCTAGACGAAGACACCATCGAAAAC
ATAGACGAGACCCACTTTGTGATCGACTTCGACACCAGAAAAACGCTTGGCTTCGTGGGCGAGACTTCCATTAAGTATGCAGAAGTCGTTTCAGGGGGCG
AAGGAATGACGATGGTCGTCAGACTTACCGGTGGCGCCAGCGGTCGTGTCATGTCACCGATGATGATTCTACAGAACGCCAGTGCCAACTATCCAATACG
AGGCGTCCCAGACGATGTTCAAGGCGTGTGCTACCGCACCGGACCGAAAGGGTGGATGGACAAGCGTGTGTTTCGTCAGTTTTTGCTCGAACGTCGAGCC
ATCCGTGCCGATCCTCACGGAAAGAAAAAGGCGATCTTTCTCGACAACTGTGGAGGGCACCTGTCAGCAGACGAATGCGCTGAAGAGCTGCGAATCCTCA
ATGCGGATCTGCACTTTATGCCACCCAACTCCACTGACCTCTGTCAGCCAGCGGATTCGTTCGTCATCGCCAAGCTGAAATCGATCTGGGCGCGAAAGTG
GAATGCCAAGAAGCTCGAGCTGATCATGGACGGGGATTGGCAGGACAAAGTGCGCAACGATAGTGCGTGGTCAGGTAAGTTGAAGAACCCAGGGAAGCCT
TTCTTCTTGAAGCTGGCCGCTGAGTGTGTGCAAGAGCTCAACACCCTCAGAGACAAGAACGGGCTGACGTATGCTCGGAAGGCTATGATTCGCTGCGGTA
TGTCCCGAGACGTTGATGGGAGTTGGACTGTGGCACAGCTGTACCCCCACCTTCAATAAATCATCAAGGAGTACCCCGATGAGTTCGCAAGAAAGGACAA
CACTCCATCAACTTCATAAAATTTTATTCTTGCTTACATCCTACTCTTGGAGTTGTGATACGATATCCCTCTGTATGCCTGGGGCCGCTGTGACTTCGAT
TGTAGACGCAGTGTTCTGAGATATCAGAACGAGCATCGAATCTTCGTCAGAAGGGGCGCCCGACTCATGGTGCTTAGCATACTGGCGGTCAACCTGTTCA
CACGAAATGCCGGACGGCGGTCGCGTTAGCAGTTCTGTGCGCCGGCTCTCGATGTGAACAAGAAACCCCAGTATGATCCGCATCATGATCCGAATCAAAT
GTTGGTGGATGGAATCGAACCATCGACCTCTCGTTTGGTAAACGAGCGCTCAACCACTAAGCTGCACCAACGTCACGTCCCTGTCGCTGATTGGACACTA
CCGTATTCCTCTTCTTAACGCTGACGACTTCTTAAGGCCGACAATCACAAATTAGCCAATCACAGTCTTAGTAACAGCCATACGACGACACACTTCTTAA
AGCTGACACTACAAGTTGAAGACAAACGATTTTGGGAAACCGTCGCTGCCACGTGCCTCGTACCGCTCGGTATTCTCTTACCGCGTCGGAAGAGCTCGAC
GTGCCTTCGCGCAGTCAGTTCCTCATTCTGCAATCGTCCACCAGTAGCACAACATCCGAGCCCCTCCACACTCCACCGTCACCATGCGCCAAGGTCGAAC
CAAAATCCGTAGCGAGGGTGGTTTCGTCGCGTCGCGGCATGTGTACGAGTCGCTGAGCAATGGCCGCAAGCTTGAGATTGCGCTGTTTGCCCGCATTGAG
GGAGCTACGTCAGCTGTCGACAAGTATTGGCCTCTTGTGGCACCGGACGTCAGGGAATCAAAGCGCAAGCTGATGTACGAGTGGATCGCTCAAATTCCAA
AGCTCGAGAAAGTGTGTCAGTCTCACCGCGGGAGGAACAGCAAGCGCTCAAGGAAGGTGGGCTCGGCGACAACGCTGTCTCGTGATGCTGAGCGCATCAT
TGTGCAGTGGGTCAGCTCGCTACGTGACGATGGTGTTCCGGTATCATCGCTAATGTTGCGCGTCAAAGCGCTTGATGTCGCACGTGAGTTTGGTGTATCT
TCGGAGCACTTTCGAGCGTCAAGGTCGTGGCAACGACGTTTTCTTCGACGCCATCGCTTATCGTTTCGTCGACGCACTCGCTGTGGCCAAAATCAACCAA
GCCTTGTGGAAGCGGTGGTCAGAGAGACGAACAGCAAAATCAACAAGTTGATGGTCGAGCACGGTGTCGACGTTGTCTACAACGCCGATCAGACGGCTGT
ATTCTTTGAATACATACCGACGACCACCTTGGCCCCCACGGGAATCAAAACTGTATGGGTGCGGACCGCCGGGAAGGATAAGGAGCGAGTCACTGTCATG
CTTCTCGGTGACTCGCACGGGCGAAAATTGCAGCCGTTCGTTGTGGTAAAAATGAGAGAAAGCTGCCGAGAATCATGCGAGACGCCACGGCTTCGGCGAG
AAGACCTGGAAGGACATGAGAGCAGCTCAAGATGACAACGGCATGAAGATCTACGCAAATGCCAAAGGGTGGTGGACTGGGGACATCAGCTGCAAGTTTC
TGCGTTATCATTTTGGAGGACGCCCGGATATGGACCGCCCTGTCTTGCTGCTGTGGGATGAGTTTTCTGGACATTGGACAGACGATGTTCGCCAATGCGC
TGCGATCTTAAACGTGATTTTAATTCCGGTGCCGCCAGGGTACACCAGCATGTGTCAGCCAGCCGACATCGCTTGGAATCGACCATTAAAGATGCGACTG
GTTAAGCTTTGTTACCAAGCAAGTTCTAGAGAAGCGTCAGCAGGGGCGCTTCAAGCTCAAAGCGCCCACAAGGACCGAGATCATGGGTTGGATTGGGCAT
GCGTGGGCCGGATTGACAAGCGCGACCATTGCGAACGGCTTCAGATCAATCGTTGATCAGGTAGGTGATGAGACTGAAGACTATAATGTGCTAGTTTCAA
CGCTGGATAAGCTGGATCTGCTTGACAAGCGACTTGGCGTTATCCGCGACAGCGACGATTTCGTTGGGAGCGAGCTGGCGATGGCAGATCTGGCAGATCT
GGAATTCGAGGAGGACAGAGATGCTCAGTTTTTGTAGCCATAATAGGGATGGGGGATTTTTGTCCGTATCCGTCAGCTTTAAGAAGAGGAATACGGTAAT
TTCTTGTTGTCGGAAAATACTGTCCTCGACACTATTTCCTTATCAGGGTTATTAGAGTCTGTCGAAAATTAGCGCGACGGACACTAATTTCCATATTTTT
CGATTTAGGTCTCGGTCGAAAATTAGTGTCACTGACACTAATTCCAATAAGCACTGTAGTGAGCTTTCTATCTCGATAGATGTTACTACGTACTTCGAAG
CAGTATGTACTCGGCCGGCACTAATATCGTCTAGGCGATGCTTTTGATGCGGTCGTGTGTGCAGCTAAGCAAACAACAAGTAGGTCTCGACAACAAATGA
CAGCATCGGTCTCGTAATTTGTCCAAGTTCTTCAGAGCACATTTTACAAGTGTCACCACAAGACCTGAAATCCTAGTGCCGGTTCGGAACGGTCGTCCAT
TCCTCGAAGTAGATCGGAGGGAGTCAACCCCTAGTGCTGAGCTTTGTAGGCGAGGCCCAGACACTTCCTCGTCAATGTTCCAGACGCAAGATGGTGCTGG
CAGCAGCTACACGTCGACGATCTACGGGTTCATCCGCGACCAAAAGTACGAGGAAGCGGTTCGGATTCTTCAGATCGAGCTGGAAAACCACCCGCACAGT
CGCGCGGCGCTCTCGTTGCTGGGCTACTGCTACTACCACATGCAGCTCTTCCACCAGGCCGTCGGGATGTACGAGCAGCTCTGTGCCAACTACCCCGAGG
TGGACGAGTACCAGCTCTACCTGGCGCAGTCACTGTACAAGTCCGGCCAGTACGACGCAGCTTCGAGACGAGCTAGTCAGCTCGAAAGTGAGCAGTTCGC
ACAACGCGTGCACTTGCTGAGAGCGGCCTCGTACTACGAGCAGAACGATATCAAGGCCACGCGCTCCGTGCTGGAGGAGTGTCTACCCGATGACCCCACG
ACTATTGTGTTTGACGGGGCCATTGAGTACAAGGAAGGCCGCTACGAGGCTGCGCGCGCCAAGTTTGCAGACGCGCTCAACATCTTGGGCTACCAGCCGG
ACCTGTCGTACAACATCGCGCTGTGCTTCTTCAAGATGAAGCAGTACGGCAACGCCATGAGGCAGATCGCCGAGATCATTGAGAAGGGCGTGCGAGACCA
CCCCGAGCTGAGTGTGGGGAGCAAGAGCGAGCAGAATGTCGACGTCAAATCTGTGCGCAACTCGACGGTCTTGCGGGAGACTGCGCTGGTGGAGGCGTTC
AACCTCAAAGCAGCGATCGAGTACGAAATGAAGAACTACAAGGGCGCTCGAGACGCGCTGCTGGACATGCCGCCTCGCCAGGAAGAAGAGCTGGACCCGG
TGTCGCTGCACAACTTCGGGCTCATGAATATGGACGTGGATCCGAACGGCGGCTTCAAGAAGCTCAACTTCCTGCTGCAGAACCCGCCGTTCCCGGCGGA
GACCTTCTCCAACTTGCTCATTCTGTACACGAAGCACGGCTTCCACGACCTCATGGCCGACGTGTTGGCGGAGAACGCTCATCTGACGTTCCAGCTGCTC
TCGAAGGACTTCTACGACTTCATGGACGCCACCGTGACGCTACAAACGTCGCCGGAGGATGCCTATCGCAAGTACGACGAGCTGGCCACCAAGCACGTCG
AAGGGCTGCGCAAGTTGACCAAGAAAATTCAAGACGCGCGCCTCGCACAGTCCAACGAGGACATCAAGACGTCCTTGAAGGCCTACGACGACGCGCTGGA
AGATTTCATGCCCGTGCTGATGGCACAGGCCAACATTTACTGGGAGCGGGGCAATTATACGCAAGTGGAGAAGATTTTCAGGCAGACGGCCGAGTTCTGC
TCGGAGCACGAAGCCTGGAAGCTGAACGTGGCGCACGTCTTCTTCTTGCAGGGAAACAAGTACGAGCAGGCCATCCAGTACTACGAGCCGTTCGTCAAGA
AGCACCAAGACAACCTGCTCGACGTGCAGGCCATCATCCTGGCCAACCTTTGCGTCTGCTACGTGATGAACACGGACAATGAAAAGGCCGAGGAGCTGCT
GCGCTCCATCGAGCGAGAAGAGGAAGAGGAGTCGAGTCGCGACCCGGACAAGCGGCTCTTCCACCTCTGCATTGTCAACCTCGTCATCGGCACGCTCTAC
TGCTCCAAGAACAACTACGACTTTGGCATCTGCCGAGTCATGAAGAGCATGGAGCCGTACCATCGCAAGCTGGGGCCAGACACTTGGTACTACGCCAAGC
GCTGCTTCCTCGGCCTGGCACTCACGCTAGCCAAGTACATGACCACTATCCGCGACTCGACCATGGACGACATCCTCGAGTTCCTCGATTGCGCGGACCA
GCACGGCAAGGACATCTTCACTACTACTGCAGCCGACCAACGGAACGCCGGCATGACGGGAAACGATGCCATTCAGCACACCATCAGCTACGAGGTGCGT
CTTGTGACTGCATTTGGTGGTTCTATCATTCTGTCGTAAGCTTTGTTAATTCCTTCCTTGGTGTTGTTATCATGCACAGGCTCGCGTTCTGAAGCGCACC
TTCCTCAAGCTGCGCTCGTAGACTCTGCTGTGAAGCTCAACAAGTGGGGCTCCTTGGTTCGGCAACTACGCTTTTACTCAATGACTGCTGCTTCGCTAAT
AGTTTTGACTGCACGATTCATGTGCAGGTTTGATGAAACACATTAAGATCAGACATGGCCAATAAAAAGAAAGTTGAATTGTGTTGAAGTTGCCTAGAAA
GTGTGAATCCACGAACTCGTACCCACTCGAAGATAACCGGAGGGTCGTCATCAGCATGCAGGATTTCATCGTGTAGATGCATTTCTTTCGTTGCTCCTTA
GGACATCCTTCAGAAGTACTTGGCCTTCGTTGTCCAACTGGCGAGCAGCGCAAGGTAGCCCCTTCTTCTTCTTCTTCTGCTCTGCGCTAGCGCTGCCCTT
CTTCCCACTGCCGTCCTCCTTCGGACCGCTCTTGTTGTTGGGGGTCTTGTGGCGTGACATCTATCCTTCCTTTTCGGCAATGGCGACTGAGCACCGAGCG
TGCGGGGCTCTCTCTCGACTAAACGCGAGCTGCTCTCGTTAGAAACCATCGGCCGATACCCGATGACCCAAGTACTCTACCTTCCGATGTCCCCAGAAAC
TCTTGACCACGCTGATCGACAGGTTCCATCGCTCGCAAGCGTCAAGCAGTGCCTCGACCTTCCCACTAAAGGTCTGCTTGACCCCAGATTAGTTGTACAC
TGTTTATATAACCGCTTGTTACCACGAGATTCTAGCATCGCATAATGCTACGAACTCCAATTCAATGGACGCCGCTTTCAAATTATGAAATTAACACAAG
TACTATTACGGGCCGATAGAGACTCAATGTAACTCGGTAAAGGCCAGTTGTGTGCTGAAGTCGTTCGCTTGGTTTTGTAGATACCCCCCATTACCCCACA
CCTGTCGACACCTCCGATTTTCGTGTTTTTAGCGGGCATCTGCTTATATTATACAGGTAAGCCGCATGGTGTACGCTTTAGCAGACTTGGTTTGTACCTG
GAACAACCTTCAACTAACGCAAGGGTAGTCTCTTGGAGCTCAAGACTTCGCCGGCACTAGCCCATGGACTCGCTGAGCATTCACTCGTTCGAGAGAACAA
CGGGGACAGCGGCATTCGCTGTCGTGTGTACATCTCCCATTGGTGTGTCTCCCCAAAACTCAAGGATTTTGCGTGAGATTCCAGTGCGCGGCGAACGGGC
GGCTTCGCGATGAGGTCGAAATCTGGCGGAGCAAAACTGGTCGCGATCGTTGAGGTAGGTGAGTTTGTGGCACAGTTTGGTGACACAATTGGTGGCTCGT
TGCTCGGCGGTGCACGTGCCGTTTCAACCAAGCTCGTCACGTTGCTGGAGCACTTTGACACGCCACACTCTTGGTCGTGTGACTTCGCTGTCATTACCTT
CTTGGCGTGCGCCTTGCACAAATCTTTAATCTGCCTGAACTTTTGGCAGTTCGGCACGCTGCAGCGTCGACCACCCCCGTGAACGAGGCATAACCGTCGA
GACTGTGAAAGCTTCTCGCACCCTTCCACTGAACAATGCCGGCCACCGCCATGCTTCACGCACAAAGCTCGAGTCTGAGCGAGCTTTCCGCAGCTTGGGA
CTCGGCAGCGCATGCCTCCCCCGTGGCCCTTGCAAAGTCGCCCAGTCTGCGCCCTCTTGTTGCAACCAGGCTCGCTGCATTGGGTAGGCTTGCGGGAAGT
CGTTGATTTGGTCATGATTTACCTGGTGTGGTGTGCTGGAGCTTGCAAATTATCGGAATGGAATTCGATTCAGACTTATAAAGTGTGTATGAATCACGAC
TCGTGACCCGGAGATTGGGGGGATTACGCTCTATTTGTTGGAACGAAAGCAAATTCATGAGTGATTTATTGAGAGAGCAATGAACTCGGAATATGCAAGC
GATGGACAACGGCTGACACCAGTCATCCTACCTTGGGTCATCCTGGGGAGTTCAGTGGTACATGAAGTTGTGGATGTTCAAGCTGGTAGTTCCAACATTA
TTTACTCCAGGGGGATTACGTTTGATTCGCTCCGCGTGACCAGCTCAGCCCTCGGTTTTGACTGATTCACAGCCTTAAAACCCATAGCGGCATTTAGATA
TACCGGATATTCTTTGTTATGAATTACACCCCACCGGAGAAGATACTACGCCGCTCCGTTCGAAATTGCGAGCCCACTTTAGCACGAGAACCCGTCTTCC
TGTGTATTTAGTTTGAGGTAAATCAGGGGGGAAACATCTATCGTGTGCCGCATTTTCCGATGCAGCCTTGGGCAGAAGCTTTCTTTGTAGCGGCAGCGTA
TGACCGGAGGACGTGCTTCTCCTCCCTTCTTCCCTTGCCTCCAGGCAAGCGGGGGCGGCCTGATGGCGCACGCGCCATTGAAGAAATGAAAAATGACTGG
TTTGTAGCCGCTGTATCCCTTAACAAAGAAAACATGCACAGGCTCGCGTTCTGAAGCGCACCTTCCTCAAGCTGCGCTCGTAGACTCTGCTGTGAAGCTC
AACAAGTGGGGCTCCTTGATTCGGCAACTACGCTTTTACTCAATGACTGCTGCTTCGCTAATAGTTTTGACTGCACGATTCATGTGCAGGTTTGATGAAA
CACATTAAGATCAGACATGGCCAATAAAAAGAAAGTTGAATTGTGTTGAAGTTGCCTAGAAAGTGTGAAACCACGAACTCGTACCCACTCGAAGATAACC
GGAGGGTCGTCATCAGCATGCAGGATTTCATCGTGTAGATGCATTTCTTTCGTTGCTCCTTAGGACATCCTTCAGAAGTACTTGGCCTTCGTTGTCCAAC
TGGCGAGCAGCGCAAGGTAGCCCCTTCTTCTTCTTCTTCTGCTCTGCGCTAGCGCTGCCCTTCTTCCCACTGCCGTCCTCCTTCGGACCGCTCTTGTTGT
TGGGGGTCTTGTGGCGTGACATCTATCCTTCCTTTTCGGCAATGGCGACTGAGCACCGAGCGTGCGGGGCTCTCTCTCGACTAAACGCGAGCTGCTCTCG
TTAGAAACCATCGGCCGATACCCGATGACCCAAGTACTCTACCTTCCGATGTCCCCAGAAACTCTTGACCACGCTGATCGACAGGTTCCATCGCTCGCAA
GCGTCAAGCAGTGCCTCGACCTTCCCACTAAAGGTCTGCTTGACCCCAGATTAGTTGTACACTGTTTATATAACCGCTTGTTACCACGAGATTCTAGCAT
CGCATAATGCTACGAACTCCAATTCAATGGACGCCGCTTTCAAATTATGAAATTAACACAAGTACTATTACGGGCCGATAGAGACTCAATGTAACTCGGT
AAAGGCCAGTTGTGTGCTGAAGTCGTTCGCTTGGTTTTGTAGATACCCCCCATTACCCCACACCTGTCGACACCTCCGATTTTCGTGTTTTTAGCGGGCA
TCTGCTTATATTATACAGGTAAGCCGCATGGTGTACGCTTTAGCAGACTTGGTTTGTACCTGGAACAACCTTCAACTAACGCAAGGGTAGTCTCTTGGAG
CTCAAGACTTCGCCGGCACTAGCCCATGGACTCGCTGAGCATTCACTCGTTCGAGAGAACAACGGGGACAGCGGCATTCGCTGTCGTGTGTACATCTCCC
ATTGGTGTGTCTCCCCAAAACTCAAGGATTTTGCGTGAGATTCCAGTGCGCGGCGAACGGGCGGCTTCGCGATGAGGTCGAAATCTGGCGGAGCAAAACT
GGTCGCGATCGTTGAGGTAGGTGAGTTTGTGGCACAGTTTGGTGACACAATTGGTGGCTCGTTGCTCGGCGGTGCACGTGCCGTTTCAACCAAGCTCGTC
ACGTTGCTGGAGCACTTTGACACGCCACACTCTTGGTCGTGTGACTTCGCTGTCATTCCCATCTTGGCGTGCGCCTTGCACAAATCTTTAATCTGCCTGA
ACTTTTGGCAGTTCGGCACGCTGCAGCGTCGACCACCCCCGTGAACGAGGCATAACCGTCGAGACTGTGAAAGCTTCTCGCACCCTTCCACTGAACAATG
CCGACCACCGCCATGCTTCACGCACAAAGCTCGAGTCTGAGCGAGCTTTCCGCAGCTTGGGACTCGGCAGCGCATGCCTCCCCCGTGGCCCTTGCAAAGT
CGCCCAGTCTGCGCCCTCTTGTTGCAACCAGGCTCGCTGCACTGGGTAGGCTTGCGGGAAGTCGTTGATTTGGTCATGATTTACCTGGTGTGGTGTGCTG
GAGCTTGCAAATATCGGAATGGAATTCGATTCAGACTTATAAAGTGTGTATGAATCACGACTCGTGACCCGGAGATTGGGGGGATTACGCTCTATTTACT
CCAGGGGGATTACCTTTTTTTCGCTCCGCGTGAACAGCTCAGCCCTCGGTTTTGATGGTTCACAGCCCTAAAACCTATAGCGGCATTTAGATATAGGGTA
CAAAGCTGGGTCTAGATTTCAAAATCGAGGTCAAAGTCGACTGAATCGCAGCCGTTATTGCGCTACGAGTCGCTTTACAAACGCATTCCTGAGGCTTCAG
AATTGCGGGAAACGGGTTGCTCTTGAGGAAATACACATGGGTTTACAGGAGAAAGTGCAAATGTAGTAAAAACACATCCACAGATATTGTAAATATTCAT
ATGAACCGCAAGCACTTCTGCCGAGTTGTAGCGAGTACTAGTACGCTTGAGTCAGACTCTGACATCTGTGGTGGAATCGACCAGGGATGCTGGTGACGTC
GCCCCTAATTATTTTGGGCGATCTGGTCAGGTTACCACAGCAAGTATGTATTCACAAAATCTAGTCGAACAGCAAGAGTATTTGCCTGCTTTAGATGGCC
TACCCAGCTCTCCGAGATGGTATACAGCCTCGCATTCGCACAGGTTTGGGGCCGACCCAGTTTTCGCTGAAACATCTTTTGTAGTGGTTGTTCCCTTCCT
TCTTGCTTATCGAACTCGTTGGCATCTCAACCTACACTTATTACCTACGCTGTCGTTGTAGTGGCGATGGTTGCGTGAGCGGTTGCTGTAGCTGGAGTGA
AAGAGTATTTGTGTTCGTTGGTAGATGGTCGACAGATACACTGTAGTAAACCACTGCTTTCTGAGACGAGTCCCACAAACTTTGTCGAATTCCTTCAAAT
AACATTTTCTCCCGTCATTTCTGAAAAGGAAAGACCGATGGCACGCAAGAAGACCCCCGACACGGACGGCTCGAAGAAGGACAGCAATGTGAAGAAGGTC
AATGGTAAGCCTAACAGCACCAAGAAGAAGACGAGACAAGATGGACCAGAAGTGGGAAGGGGGGACGGCGGAAGGGCGACGCCTTCATCTGGTTGAAGGT
GGAGATCGCTTTCACGAACTCGTTGACCTTCCTCCAGTCAAAGATCAGCGGGGGGTCGTCGTCCCCACGCCTCGCCTCCTACATGATGTTGTCGTACAAG
TGCATTTCGTCATTGCGACGTAGGACGTCCTTCAGGGGCACCAACCCTTCGTTGCCCACCTAGCAAGGAGTACCGGGAGGTTTTGTCCTCTTCTTCTGCC
TACAGGCACCAGAGGTGGCTGAAACACTGTAAAAACATCGCTTGGTTCGACGAACGCGTTCGACTTGGGTTGCTCTATCACCACAAGCTATTCGGAAGGT
GTGGTGTGGCTCTGTCTAGAGTAGTCGAACGTGGTCGCGGCACGTAGACGCCTGCGATTGGTACAGCGTGCGGCACTGCAACGGCGATGATGCGGCGGAT
CCAAGGGTCGGTGTTGAGATCCCGCAGCATAAATATCATGTGACAGCACTGCGCCAACGAGCATGGGAGGTACGTGGTGTCGAGACGAGCAGGAGCTCCT
TGGATCC