Description :
From Genome Similarity Track
Location :
scaffold_854:1954- 3943
Transcript NameFunction/comments
g10461.t1 hypothetical protein PHYSODRAFT_249657

Sequence
1989 bases(100 bases per row)
TGCCGTACTACTTTCGCACACTGCCTTGGCGTGCAGCCGCTGACTGTACATCGCTACAAGCGCCGCGTCCGCGACGGTAACATAGCGCCAAAAGAGCATG
ACAACAAATTAAACAAGAATGCATCCACCATTGACGCTGTGTGGCTAGTCCAGTGGTTCGAGCAGTTTGCAGCTGAGGTTGGCGAGGTACTACCCGTGAG
AGTGCGCATGCAGAAAACCAAGGACGGTGTTGTGCAGAAATACTACAGTCGCGAGAACTACACTCTTTTACCAGCTATGTTTACCTGGGACGTCCTCTAT
GATGAGATGCACAAGTTCGTGACTAGTGGCCTCCGCGTCAACGAGCCAGAACGCTCTACCTTTCGGAAGCTGCTGTCTCTTCACTGCCCCACAATCAAGA
TCCGGTCTGCGCAGTCGGACGTCTGCGATCTGTGCACCGTGTACCAGACACGCATGCGAAACCGTGCGACCGCAGAACAAACTGAAGAGCTGGGCCAACA
CACGGAGTCTGCACGTCGAATGAGGTACGAAGTCATAAGTATCATTTTGAATTAGCGAAGGATACTGGTATCAATTTGATTTACTGTGAACTTTAAGACA
CGAGTACAAGAAGGATAAAGCCGCTGTGCACATAGAAAATGAAGCAGGCAGCGACTTGGCCGTGATCGTCATGGACTTCTCGCAAAATCTTACGCTTCCG
TCGGTCACATTGACGCCTTCGCCGTGGTACTGTTGCTCTTTGCTCGCGGTGAGTGTCTTTGGCATTTTTTACAAGAATGATGGCACGCAGACAAACTAGG
TGTACGACGAATTCACAAGCGGAAAGGGCAGCGACCAGCTAAACTCTATGCCGCAGCATTTCATCCGTACCGTACTACTTCCAGCAGGCAAGAAGCGCCT
TATTGTCTACGCGGACAACTGCTCTGGCCAGAACAAGAACAACCACGTTATCAAGTTCTTCCTCGAACAAGTTCACATGGGTGTCCTCGAGCGAGTCGAC
TACAAGTTGTTTGTGAAAGGCCACACAAAAATCTCCTGCGATCGTGGTTTCGGCCACATCCGCAAACACGTAGCTTGTCAGGACAGCTGGATTTTGGATG
ATATTATCTCTGTTGTGAAGGATTCAGCTAGTTCGAACACTACGGTGCACATTTCGCGTGGACATACCTTTTTCATGAGCTACAAACCGCTCGTTGCAGA
GCGGTACAAGACGTTGGTCGGCGTTCAACAGTACCAATTGTTTTCCATGGACAAAGACCAACTTGGCGTTGTTCACTGCTGCAAAGGGCCCGATGACGAA
CCTGTGCTGCAAGACCTACGGCGCAAAGTCGACGGGCTGCTTACGGAGCCTGACAAGGTGTCCCGCATATTTACACACTTCCTGGAAGACCTGAGCCCTC
CCCCACTCAATACTGAGAAAATACTGGAACTACACAGCAAGATCCGCCCCTACGTTCCAGAAGAGTTCCAGAAGAACCACATCTATGCCGCGCCAAGCGA
GCAGCAGCAGACAGACGCTAAGACAGCCAAACAAGCACGCCGAGAGCGCCGAGCTGCCATGGCAGCCGCTGCCAAGGCTAACCAGGATAGCCGCGGACGA
GATCCCGATGGAGAAGCGCATCATATCCCAAAGAAGTCGCGAAAGTGAAGAGCAGCGACTCTTTAGCTGACATTGACGCTCGAGTAAAATGATACTTGTG
TCCGGGCGAAAACGAAATGATACTTGTTGTATCCAATGTCACTATTGTAAAATTCTGAACAATAACTAACTTTTCATCATGTTCTGATGCGATTTTGAAG
AAATGAGCATCGCCATTGGCTCTGCAGCGCAATGTTACGTCAGATTAGCCAATAAAAACATCTCATTTTTGGTCTGGGACGGGAGATAATGTTTTTGACG
AACCAATTCTCGGTCGGTTCTGGGTTCCAGGAGCTCTACGTGGTCTCAAAATGAAGAGGAAATACCCCTTTTTCCAATAGTATCCTTAA