Description :
From Genome Similarity Track
Location :
Scaffold_4:1953678- 1989369
Transcript NameFunction/comments
Phyin_T30-4PITG_03492Exportin-2-like protein
Phyin_T30-4PITG_03493Amidophosphoribosyltransferase
Phyin_T30-4PITG_03494Putative uncharacterized protein
Phyin_T30-4PITG_03495Putative uncharacterized protein
Phyin_T30-4PITG_03496Putative uncharacterized protein
Phyin_T30-4PITG_03497Separin%2C putative
Phyin_T30-4PITG_03498Octanoyltransferase%2C putative
Phyin_T30-4PITG_03499Phosphopantothenoylcysteine decarboxylase%2C putative
Phyin_T30-4PITG_03500Chromodomain-helicase-DNA-binding protein 1
Phyin_T30-4PITG_03501Alcohol dehydrogenase%2C putative
Phyin_T30-4PITG_03502Alcohol dehydrogenase%2C putative
Phyin_T30-4PITG_03503Putative uncharacterized protein
Phyin_T30-4PITG_03504Putative uncharacterized protein
Phyin_T30-4PITG_03505Putative uncharacterized protein

Sequence
35691 bases(100 bases per row)
CGCAACTCTGAAGGGTACACGAAGGAACTGGTCTATACGGTGTCCGTTCTTATTGGAAAGCTCGGTCCGGACACGTTCCTAGCGTCTCTGGAATCACTGC
AGAAGGGAATGTCGACCATGTTCATCAAGTCTGTGTGGCTGCAGTGCAATGCGCGTGGTCGCAGTCCCGCAGAGCGAAAGGCTTGCGCTATTGGCCTCAC
AAGACTGATGTGCGAAACGGAGTTCTGCGGCGCCGATTTAGATATGTGGACGGAGATGTTGATTGCAGCGGTGAAGGTGCTGGAGGAAGCTGGAGACAGT
GGCGCTGCAGTCAAGGACGAGGATGAATCGCTGCTGGAGTTGGAGCAGACGGGTTACGAAGCCGGTTACGCGAAGCTGTTCTTCGCGTCGGTGATTCCAC
TTGACTACTTGCAGGAATACCCCGTGCCGACATGCTACCTTGCTGAATCGATCTCGAAGCTGTCAGCCTCCAAACCTGGCGTGGTGCGTTCTTTTACTTA
TTTCAAGAAGTGTCTGTGGTAACTGACACTGTATATGTTCATTTAGCACTTGGCGTACGCCCAGACAGAATTGCCGACGCCCGCAACGTTGACGTCACTG
CAGTCGTATTTTGCGCAGAACAACGTGCCATTCCAGTAGATTGGGTAACATGGATCGACGGAAAACTTTCCAATGTCCGACTTACACTTAGCAAATCTCA
GAGTGTGGGGGGGAAATGTTGCGCAGCATGCAGCAGCATTCCATCACGAAAGTTCTATTTGTTGTGTTTCACTAGGAAGAGAGCGAATTTTTTGCAGTTT
TTTTTTGCATGCTCTCCCTCCGACATACACTAGTTTGAAGTATTTATCTTCTGTGTGTTGGGAGCGTTTGGAAAGAAACTGGTGTGCATTTCTTGCTCTA
TGTAGAGTCTACAGAGGCGAGAGTTTCCGACAAACCCTCGCCATACTCAAAAGAGCGAGGAAGCCACGCTCGGATGACATTTCCTCGGCCCTTCCGATCT
CATCGGTCGTTGTTAATGGTCTCGTTCAGTCCAGGTTGGGAAGACTTCCCCACATTTACTGCGGAGCGTTGTACATGTCAATGCTCTCATCGGACTGCGG
AGTGGAGATGGTGCGGTTGAACGGGGTGAAACCCATGTTCTTGGCCTGCATGCGCGCATCGCAACGCTCAGCGTGCAACCGCTCGAAGTACGCCTGGTTC
ACATCACCCGTGACGTATTTGCCGTCGAAGCACGACGAGTCGAAGACATCGAGCGCCGAGTTCTCCTGCCGCACGGAGTCCTCGAGGTCCTTTAGATCCT
GGAAAATCACCCACTCGCAGCCGATTTCCTTAGCCACCTGAGCCTCCGTCTTGTTGAAGGCGATGAGTTCCTCGGTCGTGGGCATGTCAATGCCGTACAC
ATTGGGGTGACGGATAGCAGGAGCCGCCGACGCGAAGTACACGGCCTTGGCGCCGTTCTCACGGGCGATCTGCACAATCTGACGCGACGTGGTGCCACGC
ACGATCGAGTCGTCCACAAGCAACACAACCTTGCCCTCGAACTCGGAGCGGATGGCGTTCAATTTCATACGCACCGTCTTCTTCCGTGCGACCTGGCCAG
GCATAATGAAGGTGCGCGCAATGTAGCGGTTCTTAACGAAACCTTCGCGGTACGGAAGGTTAAGGCTCTGCGAAGCCTCAAGAGCCGATGTGCGGCTTGT
GTCAGGGATAGGAATGACCACGTCAATGCCGTGATCAGGACGCTCGCGCAGGATCTTCTGGGCGAGCTTGGAGCCCATGTTACGACGGGCCTGGTATACA
GACACGCCGTCGATAAACGAGTCCGGTCGGGCGAAGTACACGTGCTCGAAGATACACGGCGACAGCTTGGCGTCCGGTACGCACTTACGGGTGGTCATCT
CTCCGCTCTGCTTGATGACCATAGCCTCACCGGGAGCGAAATCGCGCTCTGTTTTAAACTCGAGCGTGTCGATGGCGACACTCTCAGAGGCCACGACGTA
GTCGGTGCCGTGTTGAGTCTTGCGAGTACCGTACACAAGCGGGCGAATGCCGTGCGGGTCGCGGAAGGCGACGATGCCGAAGCCGTTGATGAGCACGACA
GCCGAGTAGCCGCCGCGGCAGCGCTTGAAGACGCCGGTGACGGCATCCAACACCATCTCTGTGTCGAGTGGCTGGTCCACGCGCTTAAGCAGCTCGTCGG
CCAAGATGTTAAGCAGCAGCTCCGAGTCCGAATCCGTGTTGACGTGGCGGAAATTGGTGTTTGCCAGCTGATCCACAAGCTCGTGTGAGTTGGTGAGGTT
GCCGTTGTGGGCAAGCGACACGCCGTACGGAGAGTTGGTGTAGAACGGCTGCGCCTCGGAGCTGGAGCTCGAGCCGGCCGTAGGATAGCGGCAGTGGCCG
ATGCCCATGTTGCCGCGCAGGTTGAGCATGTGGTTCTGCTTGAACACGTCGCGCACGAGGCCGTTGTCCTTGCGTAGGAACAGGCGCTTCTTCTCACACG
TCATGATGCCAGCGGCGTCCTGTCCGCGGTGCTGCAACACGGTGAGACCATCGTAGAGCCCCTGGTTGCAGTGCTCGTACTTGTTGGCAAGCATCAACGC
GATGATGCCACACATGGTTCAAGAAGAGAAAAGGAAGAGGCAAAGGACGACAGGACTTGCGAGGAGATTGTGCCAATGCACCTGACAACTCACGGCGACC
GAATGGCTGTCAGAAAAACCTCTTGCGCTTTGTAGGGCGAGCCGTTTCGTCGGTAGCCAACAGTTGCCGCTGTGAATCGTCCAATCCAAAAAATAACGAG
ACATTATTGGTCAATATTCAAGGTGGTTGAAGTGATGCAGTCGGCAAGATGTCCTTCCAATCACGATACACGTAATAATCTTGTGTAGCTGTCTCCGCAG
GAGGGTAATACTCCGACCCATTCTTTATTTTTTTTCGTTTTCGACTTGAAATAAAATGTTACGAGGGCCTCGTGACGAGGCTCCTTCATCTGACAAAAAA
AAACGCAAAATCGACTGTCGAGACAAAATTGATCAAGATGTTCAAGCTACTTTGGGCCTGGCTGTGGAGTTAATGATTTCAGCACAGACTTTGATCTAAT
TGCTGTGGTTGACTTTTTCTTCAAATGCACTACTGGTGCACTAATTGGCCGATCGGGTGATAAGATAGCTCTTGTCGCCGTGATATTCATGAGACTGCAA
CACAAAGTAGGAGTGTTGGAGCGTTAAAGCACGATAGCAAAAAAGTATTCTTCGGGACTTGCTTACCTAAGCGGAGGTGCTTGAGAGGGTTTCGTGTCCC
TTTTCAGGATAGGTGCCGACCTCGGAATCGCCAATTTCTCGCTCGCATGAGAATCACCCGCCGCCTGGAATTGTTGATAAGGCCGGGGGTCAGATATGGC
GAACAGGCTTGGCTGTGCTCGAGGTGAAATCAACGTTTCCTCGGAAAATTCCTCTTGGATGGATTCCTGGACGAAGGTTTGGGCACTAAATGGAATATTG
GAGCGATAAATCCGAGCTGACGAAGGTCCTGGATTAACCTTTCGAAGCTGTCCGTTGCCCACATCTTGTTCATCTGCTTCAGTGTCCTTCTCATTGTACG
GATTGATAACTTCTTTGCGACACGATAAACAACGCACGAGACAGTCTTCATTCTCAGCATCCAAACCAAGCAATCGAGCCTCCAACCTGCATTTTAAAAA
CAAGAATGTTACGGTCAGTTCAGATCATCAAACCGGCAAGACTAACGGATACCTACTCTTTCAACAGCTTCAAGTCTGCTTTGCGCTTTAGGCTTCGTCG
AAGATTCTCTATCGTTGCAGTATGATCGGGTAGCTGCTTGATTTTCTCCATGAAGAGCTCGGCTTGTACATTTATCTGGGCAGGAACGTCCAGCGCTAAT
GTCTCTACCAGCATTCGCTGATTCGCGAGTGCTTCCTCAAGTAGCGAATGCCTCGCAGTTGCCTCGTTTTGAGCAGTAGTAAGTTGCATTTGTACTGTGG
TTCGAAGCGAGACGACCTCATTCTCCAAGTCCCGCACATTATCCATGGCAGGAGCAGACAGCGACGCGAATCTCGAGTCTATGGTCAACAAGCTCTGCTC
AATGTCAGCAACTCGGCGTCGGAGCGTTTCGTGCGCAGAGCGGTCGTTCTTGTCTCGTATTTCGCTCGTAATCGCCTTGAGCGCTGCAAAAATCTCTCGA
GATTTTTCTTCCAGCAGCTCAATTCTCGACGACACAGTGAAGACATTCTTCTTGCGCTTAAGTAAAATGTTTGTCACTTCCTTCTTCTGTTTTTCCTTGA
TATGGCCCTTGAGCTGGAACCATTTCTTATGGGCACGCTCTTTGAGCTCGGTTTCTTCTTCGGGAGATAGCATTTGAGCACGCTTGAGCTTCTTGAGAGC
TGTCATGGCGTTGGAAATCTCCTCGACTACAGCTTCTGCATCTTCGTCTTGCTCGTCATCACTTGAGGAATTTGACTCGTAGGCAGAAGAATCACTGCCG
CTATCTTGACTCTCTTCCTCGATATTTTCCTGTTCTGTCGTGCTTGCTGTAGCTGCAGAAGGTGATGGTTGTTCAGCGGGTGGAGGTGGCTGGGATCTGA
CTTGAGGTACTGCTTTTTCAACAGGCAATACATCGGGCTCTATAGGCTGGTCAGGGTGGGGTACGTCCTGTTCTACAGTCTTTGCATGCAGAGATATCGA
GGAGCGTCGCGAGTGCGAACCGCGTTTATTCACTGATAAGCGTCGTGCGGATTCATTGCCTTCATGCTTTTTCGTAAAACTCGTTCGAGGGGCCATTTTG
GACGATCGTCGTCGTGAAGGTGATCGAAGCGGTAAAAGTGGGTCGGCTGGTGTCTCTGGAGCGCTGATATCATGGTGCGATACTGCTTTGTCTTCTCGTT
GCCGTATTGGTGCACCGGACGCTTTAAAGCCCTTGGAAGCTGCAGAAACATGTTCCTTAGCGGGTGGAGCAACCGTGACTGGAGTTGTGTTTGCAGATGC
AATAGGCTCAGAGGGTTTTACGTCAAGTGTCACTGGCTTAGTCTCCAGAGCTGTCATTGCCACTAACGCCGGCTTAGATTCCACGATAGGGGGTGGAATG
CTGGCAATTTCTTCCTTCTCCAACGTTGTGTTAACCACCTTGGTAATTATCGGAGAGGGTGTAAGAGGGGGTTGCGTAGAAGTCACTGGCGGTACCTCCT
CTTGGTGGTCCGAACCACTACGGGTAGGCTCCAAACTACTTTTGGGTACACTTGGTGCCGCCTTCACTGTATGAGCTGAGGTTTTCAGTAGATAAGGCTC
GATGGATTGTTCTATTTGAACGGTTGGCAGGATACTTGAGACGGAGGGAGTCAGGACCGGCATCTTGTCACGAGCGTTCTGAACAAGAGTGACGTTGGGT
GTCGGAGGTTTGGCAACTGCACTACGAGTGCTTGAAGAGACTGGTTGTGGTTCAACAGACTGCATTATCGGTTCCGCTGTCGCTGATGGAGCTGCAACTG
TCTGCATAGCTTGTACCTGTGGCACAGAAAGTAAATTATCATCCAAGATGACGGGATTATTCTCGATTGACAAAGCACTAGATTTCACCTTGAAAGTCTG
GACGGTTTTCTGCTCCGTCAAACTAGACTCTGTGGTCTTAGCAATTGCAGCAGGAATTTCAGCCACTTTACTTGCTTCGTCATTGCTCGTAGACTTGTGG
TCTATCACTGTTACCGCTTCGTCAGCAGCAGTAGACGTAATTACTTCCTCCAGCACTTGCTTTGGGGGTGCATTTTCATTTCGAGAAACCTCTGAATTTG
CCGGTGGAGAGACAACTACTGCTGGAATTGGTACAGGCGGAGTCGTTGGCGTATCCTCATAAAGCTCACGTTTTGCTGAGGCCGACGCCTCTGTCACTGC
TGGTAGTGGAGCCGGTGGTAGCTCCGTTGATCCGTTAGCTTTTACTTTTTTGGCACTGTGCTTCTTGTCTTTATTTTTCTTCTTCGTACTTGGTTTCTCA
ACTTTCTCAGTTGCTGTTAGCCTATCTAAAATGGCAGCAGCCATGCCAGTCACACGAACCGCTTTCTTGTCCGTACCAAGCTTCTTGCTCACAGTAGGTG
CTACCGGTTTGGCAGATTCCGCTTGAGGAATGGCCCAGCGATGGGGTCCTTGTGCTTCGTCGTCTACTGCAGCAGTACCGTCGATATTGTGCGCGATATT
TCGTAGCTTCAGATCGATCTCCGTCATACCAAAACTCACTTCTGTAAGCCAATTCTCCAGTTTGTCCACTCGACCGCAAACCGCACGCAGAATGGCTTCC
AGAGCCATCGCTTGCTTCCCCAAATCTTTGAAAAGACCCTGGAAAACCTCTCGAGAGCCATTTCCAGGGACATCATACTGCACGTGTGCTACAGACGCCT
TACCCATCTTGCAATATCGCGCTCAAAACGAGAAGAAACTACCACACACCACGAAGAACATATCCCGGGGAGGTGGCTTATCGATAACTAATCAACCGGT
AATTGAACCGTCGTCGGGGTTTCGCTCCTCTAATTTCAAATCGCCGCGGCCAAATGGTAATGGCGATCTTGTGGCAGTCTTTGACATGCTTACTCATGAG
TATCATCGCAACAGGCGAGATATTTCACACTCTGAGATGTGTGCAGGCCACTGCAACAAATGGTCGATTCCAGTTCTCACAAGCTGTCTATTCTACAACT
GAAGACTTCGGAGTCGCCTCCATAACGATTCAACGTGGTCTCAGAGCTGGTGGAAGGGCTGCTGTTTATGTATCGACGATTCCTGGTGTGGGGAATGCTG
TGGCAGGTCGAGACTTTAAGCCTCTCTTCAATGTGAGCCTTGTGTGGCAAGATGGCGAAGATTTCGAGAAAGCACTGTACGTTCCCGTCTACAATGACGG
GAAGCCTCAAGAAAGCCCGAAGACGTTCATGTTAAAGCTGCACGATGCTATTGGTGCCGAAATCAATAGTCACCGCAATCAAACGCAAGTTGTGCTGGTT
CCGCCTTCAAATCGTGAGTTTATTCGGAGCATTTTCTTTAAAATGTGGGACTAATCGTTCATATTTGTTGCAGTGGTACCTGGCAGCTTCAGTTTTCAGA
ATGCTATGGTCAACGTAGGAGAAGGCAATATGCTAACAATCCCTGTGCTCTGGGAGGCTGGCACGACATCCACGGCGAGTGTAAAATTCGAAATTATGTG
CAAGAGTGCATGCTTTCCAGAAGACTTCGAGTTGATATCTCCAGTTACGCAGCTACTGGAGTGGAAACGAGACGAGTATCCTGTCACTTCTGCCGATCGA
ATGCAGAATATCGTCTTGAGATTGCTCAATGACAAGTTATATGAACAAGCCGAGAGTTTTAGTATCCGCCTGGTGACTGTGAAGCCTTCAGAGGACTCCA
CAATTGGTACTGGAACAATTAGGGATATTGGAGAAGTTGTGGTAACAATTAACGGTCCTAATGATGCTCGATCGGGAACACTGCAGTTCGAGGCCGAATG
TTTTCCAGACTGCGCAAGTAAGAAATACTCCGTACAGTCTGGAGGTGTCGCTCTCGTGATGATTCAACGACGCAGTGGCAGTGATGGAGACTGCTCCGTC
CGTGTGGCTACCCAAGATGATACAGCTGTAACTGGTTTAGATTACGAACCTTTGGAGCGAGAATTGTCTTGGAAAGAGGGGGATACAAGCGATAGACAGA
TAGTCGTGACTTCATTTCCTCGAGCAGATCCAAGGCTACCACCACGTCGCTTAGCACTCGTGCTTCGGAATAATAAGGGAGCTCCACTAAACGGGGCTCA
CGCTAGTACGTCGTATGTAGAAATCACCAGTCTGACTGATGTCTACCTTGGTGAGGTGAACTTTGCTACTCGCGAACCCCTGGAATCGGTGCTACGCATT
CCTGATTTCAGCTTCATCGAACTGGCATCACGTGACACAAGTTCGAAACTCCAGCTCTGTCCGAGTGTAGTAGTTACAGAGCCAGGAGTGATGTCAGTGG
CAATTCAACGCAACTTTGCAAGCTTTCCTGTACCTGTGCGAGTGACCGTGAAAACCGTGGCTGGTACTGCAACACCAGGTATCGATTACGAAGTTTTGGA
CCAGGTTGTTACCTGGGAAAATGGAGAAACCGAGGTTAAACAAGTGCTTCTGAAGATACTGGACCCGCCAACTTACGACCCTCATCCTCGTTCGCTCTGG
CTGCAACTGTCTGAGGTGACGGGCGCAATTGTTGGTGCTTGTAATGTTCTCGAAGTGGTGTTAAAAGGGATTGCGCAAGGACCTCACTTGGTTTCATTTG
ACTTGGACATGACACTCGGAATCATGACACTTCGAATGAACATTCCAGTTCAAGCTTCGACTTTGAATGTAACAACGTTACTGCTTCAATCCGAGCGTGT
GCAAAAGAACGGCCCAACTTTTAAGTTTACTCCGCAACAAACTACCACGAGTAGCACTGATGGAACCACCGTTCTGCTGAGTGTTGGTGCTGGGGACTTG
AATTCGCTGAAGCGTGTTGCCGGATTGGCAAAAGGTGCAAACTCTGCCTTTTTGAGTACGGAAGTTGGACTTTTTAAGTATGTGCTCGACAATTGCCAGA
GCACCGGGATTCTTGCCTGCGCTCCAGATATCACAGTCGAGACTTCGAGAACTGCAGCGCTGGCTGTCACAACGTTTACTGCAGATACTCATTCTCCTTT
TCTCTTAGGCTACAGCTTAGATTTACCTCGACGACTGCTGAAGTTGCACTTTTCGGAGGCTGTGAATTTCACAACTCTGAGAATTGAAGCGTTGGCATTC
GCTGAAGCAGCAGCAGGTATCGATGTCTACAGGCTTTCGTCCGCTACTACGCGCCTTTTCTCGCCACAACCAGATCCATTAAGTGGCGCTACACTGCGTG
ACGCTAACCGTTTACCCGCTGATAACACGTTTCTCACCTTGCAACTTGGTCGGTCCGATGTCACAGCTCTTAGCAGCATCGGCGCTGGTCAAATTGGTAT
CAAAAGAGCGAGTACATTCCTCGGTATCGACAGCTCTTTCGTGGCTGACTTTGCGGGGAATCTCGTCAAGGCTGTTGGACCACCAGGCACAATGTTGCAA
GTTTCAGTTGCAGATTGCTCGCCATGTCCAACAGGGTCGTATCTCACTAGCTCGTGCTTGGACCTAAAGGACCGCAAGTGTTCTACATGCAGTATATGCC
CCTGGAACTCATACGCTCTCGAACCATGCAGAGCCACGCAAGATACTCTTTGCTATCGTAAGTACACTTGGCGCAGCAGTACTTGTCTATCGCACTAACT
AGCTCGTCATTTTTCGATTTTCTACAGCATGTACCGAGTGCCGATCAGGTCAATACATTGCGGTGGCCTGTTCTCCAGCAACCGATCGTGTGTGTGCGTC
GTGCACTCAATGTACATTGGATGAGTACGAAGTTTCACCTTGCGCTGCGGGCGTGGATCGGGTTTGCCGTACTTGCAACTCGTGCACTTTAACTGTTGCT
CAGCAAGCTCTGTGTCAACGAAGTCATGAGTGGAAGCGCTTGCAAATGAGGTCACCGTTTAGTTGTCCGCAACCTGGTCAGCAGTTCAAAACTCGTGAGG
AACAATTGCAACGTGCGAAATCGAACTTATGTGGCTCCGGACGCTGCTCCTGTGTTGCTACTGGAATACCTGGCAACTCGAATCCAACCGGAGAGGGCTT
CCCCGACGATACGCGTTGCACTGGGCCTGTGGCGTACAATATTCTCGTCTAAGAGATAGAAATGCTCTCTATTCTATTGGTACTTCCATACTGTAGCTCT
AGCTAGGACGCAGCACGGATCTCGTAGAACTCGTAAGACAACTCTTGTGCATCGCTGACTGTTTCGAGAAGCTCAGCGCCGTCCGGAAGTTCGCTCACTG
GTGTAATGGTGTACGAGAGATCGGAACTCGCGGCTAGAAGCGCGTGCAGATGGATGACGCCAAAGCGACTGTGGCTGTTGGCATTCATCAGGTATGCCAC
GCCGTTGGGGCTGCCCAGTACGTGGTGGCGCACCACGCGCAGAAATCCTTCAGCTGTGCTCGGTTCGCAGATTATATCGCTGGCAATCACAACTTGAGCC
TTGGGCACAGCCTCAATACTTTCAGTGAGGTCCCAATCCAGCAGAGAAACTTTCACTTCAGGCTTCGAGGGGTCGAATTCGTGCGTAAATGGTTTGTTGA
GTTGAACATTGTACTCGAGCGCCGTGCAAGTATCTGACTGGTAGTCGGTGAGCGTCGTGTTCGTCGCGTATCGAGATGCTGTGATGCCTCCAAGTCCAAG
GCCGCTGCCCACTTCTAGCACGCTCTTACCCACGAACAGGTCGCGATGTTTATGTATCCAGCGTGCGAGAACAAAAGCAGCACCCCACAGAAGATATCCC
GTCTTCCTCTGGCCAGTCATTCGCGTTGGCACCTGACGAATAAGCACATTAAGGGTGCTCTGACTGCCGTCGGCACTTTTGGGAGCATTGTCGCGGGGGT
CGAAAGGCAGAGGCACTGCACGCGGCCACACACGCTCCACTTCTCCAATCTGACGCACACGGTGTGGGAACGTGATAGCTAATGGACTGCTCGTACACGC
TGTGACGACCTCTGCTGCAGCCTACGATTCATAAGGGCAAAGTCAGATGCTGGCGCTTTACAACACTCCGCATTGGTGGCAGCAATACTGACCTCCTGGA
TTTCTTCGTTGTCGTGCTCCATAAGCCGCATCAGCAATGGGTGAGCTCCAATACGCGCTACAATAAGAAAGCTGTCAGCACTTAAAGCATGAACAACAAG
TAGCCATCTTACTCTTACCGATAAACGTAGCATTGTCCTCATCGACAACCGTCTCGGCAACCAGTAGCAGAATCTCACGTACAACCTTGAGGTCGTCCTC
GCTCACATCTCGGTTCATGCGCTTAACAAACGCAGCCAGATGGTCCGTCGCAATCGTCAGGAACCCCGCTATCAGCAGCATCAGCAGACGTCAATTCAGG
CTAACAATCGTTCATCAGCATATCTTCATCGTACCGAGTCCAAGCACACAGCGTCCGTACGTGGTCCCCGCCAAAGCACGAACATGCTCTCGAGCAGCAG
CAGACGTGGTCACCTCTTGCACCAACGGGCGAGTCGCAGCCACGTCCACAGGCAGCGGAGCTGGCGGCGTTGAGCACAGCAGCACCATCCTCTTCTTCTT
CTCCTCCCTTATAGACTGGCTGGCTTGAGGTGATACGAATGGCGGTTACGCGCCACGTCAGTGATGTTTGGTGATTGGTGGATTCAGGATTACTAATGTA
AAACATGTCGCGGAACTGCAGGTTCGGTAGCAATAAGCAAGACGCTATCGCTACAACCGGGATAAGTTCGGGAAGTAGCCAATTGGACGAAAACCTTCGC
TCAGCTCTTGGCGACGTATAGTGGAAGTCCGTAGCAAACTGCAGCGTGGCCGTTAAGATATTTGAGCTTGCAGACGCTTCGAGACGACTGTAGTATCTGT
GCCAGCGATTGGTCGTCGTCTTCGTCGTCCTCGTCGTCCGCCAGAAGCCACTCCTGCAACACGTTGACGCTCAGTTGGTCGATGTCTCGGTCCGTGACGT
CCCAGAGCATCGCTAACACTGCCGGACTGCCAGCACGTAAATAGGCCAACACAGCGCCACTAGGTCCGAAGATTCCCTCGCGCTCCAGCCGTCCACTGCT
ACACCCGAAGAGCAGGGCGGCGCTGCAATCGGACTGCAGACTCAACACCTTGTCACGATTTAAGTATGCCTCGCCGGAGCCGTGGCCGCAATAAATATAC
AAATCTGCGGCTAATAAATAGTTTCTGTAGGAATGTACAACGTCAGAGCCAGGCTCATGAAACCAGAAGCAACGAGGCATACCTAAGTTTCTCAGGGTCT
GGGACTTCTCCCACGATCCCCTCCCAGCCAAACGATGTCGCTCCATCTTCCAAGATCGGCCCCAGTTGATGCTGTGTCGACTTGAGATCCCCAGCAGGAT
TCAGCAAATAGCGCACTCGGTCTCGTCGGACAGGTGAATAACTCTTGGCGTTCTGGACTATTAGATCGAGTGAAGGCATGCGAGTCACTCCGCTGCTGAG
GCTCATCACGTCCATGGCTTCCCATGGAAATTGCTGGAGCTGGTGATTCAGGATCAAAATGGTCGAGAAGTCGGGGTTACTACCACCACCACAGCGATCC
GTACTTGATCTCATCCTGTCGACGAGAGCAGCATCACGGGCGGCAGTGAGACGTGCAACCAGAACCTTCTTTAATCCATCAGTACTGAGCCCTTCAGCAG
CAAGAAGCTGCTTCACTTCGCCAACATTCATTCTCGCAATCTCCTCCTTGCTAAGGCTGGTCAAGTTCGAGTAGGTCGCTTCGGGTGAACTGGGTGCTGA
ATCGTCTCGACTAGTCCGAAGCACTTGAAGAGCCTCTCGAGATACGGAATCGGATAAGGGGACTTCAATCTCTGCTGCAATATGCTTCAGTCCGTCGATC
ACTTCACTGTCTGACAGATACTGCTGAGCATCCGCAATTGCACACAGCAAGCTTTGGTTCCTGTCTGCCAGTTTGATGGGGTCTGTTGTGTTCTGGGTCA
GCAAATCCCAGCAGCGACGGACTTGACCATCGAAATTAGATCCTCCAACGAGTAAACACCGCCAAAATCCGAGCGATTCCTACACATCAAAGGCAAACAG
ATTAGAGGATCCGTTGCTCATCACTCAAAGCGCGCACGGGTCCCAACTTGTTCGTACCTGCATGGAAACTACTGCTTCCTCGATGCGTCTGTCCAGAAGT
TTGCGAGTATCCCACCATTTCTTCTTCTGTTCGGCTTTCCAGGAGCTCGTTTCTTCAGCTGTGTGACCAGATAAAGTCTTCCTGTAGCCCACACATGCCC
ACAAATTATTAGCCACTCACCGCAACTACAGCTCGGTGCATCACCAACATACCTCGAATCTCGAATAATGGCATCCATCTCACGAATGCACTTCGACCAA
GACACTGTAGGCAGGCAAAACGAGGCTGGAGCAGAGCCATTTGTCTATCATAATCACACATGATTAGCTAGCCACGCTGTCACCAATGATCATACAATAC
GTACGGGAAAACGCGTAACCACGAGCTCAGACGATACGCCGATCATCAGAGAAACAATGATCCAGTTGTCTGGCAGTTGTTGAACCTCTTCAGCAATGTC
TTGGGCCATTCGAGCCAGATACTTCTGCGGTTCTTGCTTTAGACATGCGCTTGGGCCAGCAGCTAACCGCTCAAGCTGCCCCACTAAACCTTCCGGTGTT
GAAGTATCCCTGTCTGTTTCTACATAGATCGCATCACCGCTGCCAGCATTTGCCAGCAAGGCACTGCTCGCCCACGACAGAAAAGTGGCCCGTTCGTCCC
CATCCATGGAATCGGCATCGTCGTGAGAGTTTTCCTCGATATCAGCAAAATAGGCCATCCCCAACGCTGTCCGCAGCTCTTGGTTCAGATGGGGGATACC
TAGATGGTCTCCCAGCACATAAGCTTCTTCCAATAAAGAAAGCGTCCGGCCTAAGCTAGTGAACGCCCGAGGCGAGGCTGACCGCAGTAGCCTTGTATTG
ATGCGCCCCAGCTCAAGCATGCATTTGACTCGCTCCAGATGAATATCGCAGGACTTCAGTGACCGCTTGAGCTTCTTCATCGCCCCGAGGAGTGACTCCA
CTGCTCTTTGGTCAGATAAGTCGCTGACTTCGCTTTGTAGTCGTGTATACTTACGCCAGCATCGAGCTTTGACTCGTCCTAATCTCTTGGAAATGGGCGA
TCGACAGTCCTCAGCAGATTCCACAATCTCAATACCGTTCGCATAACACGCTAATGCTTCCTGTTGCTTGGCCTCATTGAGATAAACATCTCCTTGCTGA
ACAATTTCATTGCACCTTTGCTCAATGACAGCCAGATCCGACGGCATGCCAGAGTGACACGCATCAGCAATAGTGACGATAGTTTCGCTAGTTCCTGGGC
AATGCAGGTCCGACTTTGAATTAGATGACAGCAGAGAAATGGCTACTTTCGCCTTCTCCAAGTGGTTTGCATTCAGTTCCAACTCGGCGTATTCGTAGAA
CGGTCCACGGCGGAAGAAACGCAGATTCAAGCCACCAACGAGCCGCATAGCCTCCGTCAAATAAGACGCAGCCCTACGGAACAACAATCAAGCGTCTTGA
TTAGTTGATATGCCAAACAAAAACAAATAATGTGAAGAGCTTACCTGTGCGGTTGATCAGACATGCTGTAGAGAGACGCTATTCGACATAATGATACCTT
CGCAGCCAATAGCAAGTCCCATGACGAGCATTCTAGCGCCATGAAATACAGAAAATGTGCTGATTTCCGTTGCAAATATTCCCCCGCTACGATTTCTGGA
GGTAACTCGAAAAATTTGGTCTCACTGGGCGACGACGGAGCGGTGAACTTTTTCGCAATTTTCCAACAGACTCGCAACGCGGATTTAGCTTCAGCGATAG
CGTCTTGGCTTCGTCCTCCGTAAAAGTGAATGTCCGATAGTATCGTGTGGACAAACAATTGCCGCATCCCTATCGCCTTTGCCACGGGTGCAGTTTGGCA
GTACTTCACGTTCTGCTTTATGTCACCGAGTGTCTTCATCGCACGAAGCAAATGCTGGCATGCTTGATCTCTTATGGCACCCAGATGCGATGTCTTCGCA
GCAAACAAGTCTCTGTCAACCTGCTCAAACAACAGCAGCTCTCGATTATTGCCTGCAATCGCTGAGGTTTCACCCTCTGCTTTAACAATCGAGGTACTTG
AGTTCATATGAAGAAGTCCGACAGGAGGAGGAATGACATTCGGCATCAAACCTTGAGCACCTTGACACTGCTGTAATTCCCTTAGCAGCTTCCTCGCTGC
CTGTTCTAGTAGAAAGCACGAACTGAGAGATAGTGTGTTGCACACAGATTCCAAGCACTGCACAGCGTAAAGTCCATCGAACAGAAAGCCACAAACATCT
TCTCTACCCCAATAAGCCAAACAGCGCTCAATGTCTCCAATTGCGCTTTCTTCGCTGACGGAAATATCACTCCCAGGTGTAACAAATTCATCTGATGAAC
CACCATAGCTCATCATGAGAGCAATTTCCATCGTCACGACGCCACGCCATCCGTAGATCCCTCCAAGATCAACACCAACAGCATCACGAAAGCTCGAAAG
GTTTTCAGCAGCAGCAGTAAGGGAGTGGTACACGAGTAAAAGTCCCTCGATTGTGTCATCAACATTGCGTTTGGCGTAATAGCAGGAGTAAATCAGCTTA
CGCTTTGCCAAAGACTGCGAGGCATCTCGCAAAACTTTAAGAGGTAGTTCGTCGTTCATCGCCGTCATTTTTGTCTTCATCAACTCAACGTTCAAGTAGT
GCTCAAGTTCATCACACAGCTGTACGCGAATCACAGGTGAAACATCTACACCAGCATCAGATAAGGCGCATGAGTTGCCTCGCATGCTCACCACGATTTT
GGCAGATTCTCGATTGAAAGCATCCCGGAACGCTCTCCATAGCGCCATAATCTGGTTCTCAGGAATTCTTCGAGACTTGAACACGTGGGTGATATTGTCC
AAGAAAGACTTAAACTCGTTTAGGATGACAGGTAGAGCTTCCTCCCCCAATAGCTTCGCGTCTTCCAGGATGCATGACACGTACTTGTCGACACTTGTTT
GCGGCGTTTGTTCGTGCATGTCTCCACAATACAGGATGGAATACCCCGTGAACAGCTTTGCCTTTGTGCAGTTTCCCAATTCACGATAGCAATGCGCCAG
CAAGGAAGCGATGGCATCCGCTTTCAGTTGCGAATGCGCCTTCTGAATCCCTTCCAAGTTCATGTTACTGCACATCACATACTCCAGGTAACTTTCCACA
AGCTCGAACGCCCCCAGCAAAGCAGAAATCGTATCCTGGTAGTCCCCTGTTTTGTAGCAACAAGTCGCACAGCTGTAACATTCTCGTGCAATAGCATTCA
GATCGCCGAGAACTCCGTTGATAATCGAGTCACTTAGTTTCCCATCCAGGGTCGCGTTGTCCAAAAGCTCACGAACCGAAGTCACATGTCGAGAAAGCAT
ACGCAACGCAGGTTTAGTAGTCGCAGTACTATCTGCCAGACAACACCGCACCGAGAGTATAACCTCCATCCGATGAAGTCGTGATTGTTCCAGAACGAGC
AATTCCAGCATCTTAACATCCAAATCACCCACTGTAGACCGTAATTCCTTAACTGCCTTGCACAGCTCATCAAAACTGCAGTAATTGTGTTAGATAAACG
AGAAAGACAAGCCCGATTCGCTACTACTGAAGCTACTTACCTCGTAATGACTTGGTGGTATAGCTGGTATTTTGCAGAATGCTGTACACTGATAACATAG
TTGAATGTTTTCGTCGCGCTTCTCTTTAAGGAGCGAATCACGAACGGCACAAACAGAGGGTGATCTTTCGAGTCTAGTGACACGAAGCTGAACGGTGCCA
ATGCTTCGAGCTTTTTCAAATATACGCGCGCAGCCTTTTCACATTGATCAGTCCATTTGTCGGAGGTGCCGTGAACGAGATCGCGTATCATTTTACCAGA
GGCATTTTCCAGATTCTTGTCGATAGCCGAGTTGCTGAAGCCACCACGTGAAGAAGACAAACAGTTTTCTCGCTTCTCAGACTGAATTGAGCTGAAGAGA
GCACCTGCGATGGAGAATACTAGACAGGGTTCGATGAGCTTTCCGGCGCTTCCAAACAGCTGCACATATTGGACCGCATTCTCGAGAATCATGGCACTCC
TTAAGTGCATCCCAGACACTTCACAAATCAACGCGAAGTGCTCAAGCCATTGGATATATTCCCATTGAAGGGATTCGGACTGTCAGGTATTTCAAAACGC
CACACACATGTCTTTAGCTGTATGACAAAAACATATTCGCATGCAAGCACACTATTACGTACGCTGTACATGTGGGTTGAAGTGGGCTGTGCTTCACTCA
ACGTGTTCGCTGACTGATCATAAAACCAGATTAATTCCTCGAGTCCCTGTTGTGATCTTTTGGTTGCTCGTTCGTGCTGGACACCAACGCGGTGCACCTA
TCAAACCACCGAAAGAAAAGGTTAGTTAGCCTTCCGCTTCAGTTCATTTCTCACTATCGTCGTCAAGCATTTCTTCTACCTGTTGGATAAAGTATGAAGA
AGTGTAGTTTGAGCATTTGAGCAGGAATGATAGAGCTAACAAACGAAATTGGAGTGCACCACTCGTTGCAGTAGCTTTTGGTTTGACACCATCCACCGCC
GCAGCGATTTTCCACAGTACCCGGAAAGTCCGGTCACTGAACGATGACGCCAACTTTGCATCCTGCTGAGAGCTTCTTTGTAGATGCGGAATCCACGGAG
ATAGGGTTGTTTCCGCCACTAGCAGCACAGCCTACAGCGTCGCATCTTGTGATTAGTTAAGCTAGTAGGAATAGGGTATACCCCCCCCAATATACTACTT
ACCTCGTAGTTTTTCATGGCAGACAGCAGCGAGACACAAGTATTCGTGTGTCCCAGTAGTAATCGAGCGAATTGAGCAGAGTGGGGACTTCTTGGTGTGG
GAAATTCCGCCAATAGTCCGACATTTTCCATGACTTTGCTGGAGAGAGCGATATTGCCTTCATCCTGACGATCCAACAGCTTCATAAGCTGCGACTTCTC
ACTCCCTCCATTGTAAAGCTCCGAGTGCGCTTCCCAAAGTCGGATGTGAACACATGCAGCCACACAAAGCGCCACCTCTCTCATCTGCGTACCGTTGACC
TAGCTGTTAGTCGCATATCTTCGATTTCATACTAGTCGACTTACCTCAGGAATCTCCGCACACTTCTTGGCAACTTGATAGAGCAGATTGTCCACTACGA
GATCTCCCAGACGCACCGCATGCTCCAGTGTACATACCACATACAACGCCACACACGCCAGATCCATTGCTGCCACTAAATCCTCCAATTCTGCATCACA
ACAGCGATATTACGTCAAGTTTTCCTATTCATCGAGATAAAGGTATGAGTCTACTGACCGTCTTCCTTGGCTGCAGCACCGGCAGCGGCCGCATAAACCT
TCACAAGGCTCTGTGCCACCTTAGCTGCAAATACGACGTCATTCTTGCTGCTGCTGCTCACGCGCTGGCGTTTGGTGTCTCTCTCTATAGTCGGTGATTG
GGTCCAATCTGATACCCGACGCTCGACTGCCGCTCTCAGCAAGGGTAAAGCCTTTGATGACGCATTTACCGCACTGACATTGCGCACAAGAGCTGATGCT
TGAGGTGCAAAGAGAATTAGAGCTCTCTGTGATGTGCCGCGTCGCTGGACGAGCTCCAGAATTTGCTCACGAGAGGTGGCGCCAACTCCTTCGCGCATAA
TTTTTGAATACGTTTTTACTAAGTTCGCTTCTTATGCGAACTTAACGTCCAATTACGCTATTGTCCAGGCACTATTAGTGCCGCACTAAAGTGATAGGCA
TGCGCAGCGGATGGAAGAGCGTGCTGACCACAGCGTCGTCGATCACGAGACGACAACAGTTCATGTCAACTGAAGCCAAACTGAGGCGCCTCTTATCCAC
CCAGGCGATGGCGATGAAGACGCCGCAGCTGCAGCGCAAGTGCGTCGCTTATCGTCTGGGTAGCGTCGAATATGAGACTGCATGGGACTGGCAGAAGCAG
CTCATTCAGCAGCGTGTTCTGGCCATTCGCGCCGGTCAATCGGTGGAAAAGGACGTGGTTCTTGTCCTGGAACACCCAAGCGTGTACACACTAGGGCGAG
GTGGCAACATGGAGAACGTCAAATTTGATCCTGAAAAAGAGCACGTCAAGCTGGTGCGCGTCGACCGCGGTGGTGAAGTAACGTACCATGGTCCCGGACA
GGTGGTGGTGTACCCGATTATGGATCTAACGCAGCACAAGAAAGACCTGCATTGGTACCTTCGTCAGGTGGAGGAGGTGGTGATCCGCACACTTGCCAGG
TTTGACATTCAGGGCGAACGTGTGGACGGGCTTACGGGTGTCTGGGTGGAGGAGAAACACGGATCTACGGGTGATGAACACCGCAAGGGGAACTTTGAAC
GTGAAATGTGCAAGATTTGCGCAGTCGGCACGCATGCGAGTCGCTGGGTGACCATGCACGGCTTCGCACTGAACGTGAAGACGGACCTGCGTGGGTTCGA
CCGAATTGTTCCGTGCGGTATTGACGATCGCGCTGTCACGAGTATTGAGCGTATACGTCCAGATGCAACCGTTAAGGATGTACAGGATGCTGCTATCGAG
GCCATAAGCGAAGTCTTCCACCTCGATATGGAAGATGTTGAAGCCAAGACTCCATTGTAGAGTGCATATCCCTGTACTTTTGAGTATTTTGTCTCTTTTC
GATCTAGTTGGCGAGCGAAATCTGACGCAGTCGGTCTAGTGTGAAGTCAACGATGCTGTCGACTGTTGCAAGGCCTCCTTTGCCTGTAAAATACAACAAG
GTCAGGAGGTTAACGGTCCTTATGAATAGAGAATTCCGTTGTTTACTACTTTCGTTCGTACCAACAACCCCACAGGCCAATTTCTTCTCGACAGGAGGAA
TCATTTTGTAGCCGAATTCCTCCAACACGCGAAGCTGCTTTGCGGTGATCGGATGATTCCACATGTCCGTGTTCATGGCAGGCGCAAAAATGAAGGGCTT
AGATGTGATCCACGCCCGAGCGACGCAAGTCTGTTACGGTAAAACATCAACAAAATGTCAAAAACTCATGCATCTGGTCCTATATTAAAGGGAACGAGAG
ACGCACGAGGAGGTTATCCGCCAAACCATTCGCGAGCTTCGCTAGCGTGTTTGCCGACATCGGTACCAGCAGCATCACGTCCGCCCAGTCCTTAAGCTGC
AGCACATATAAGACACAGCGGGTTATGATGAGTATTAGTACAGTTATCGCCGACTGCTTGGCTCTCGTCGCACCTCAATGTGGCGCACGCTGTCACCAAC
AACATTCCACGCCGCCCATTCATCTTCATCACGAACAACTACAATCCTGCCTTGATCATCACCCGGTAATTGTGTTGCTGCACAGAACTTCTCCCAGGCG
AGTGGGTTGTAGTTCTTCGCGCGTTGCAGGAAGAAATCCGCCGCCTTGGTGAGCACCACGCACACCTGCTCTCAACAGAACAAATTTAGCTTTAAAGCCG
CAACATCTCGACCATTAACCACGCACCTCCGCGGTCTCCGATAATCGCACTGCAATCTCTGGCACCTTGACCGTCGCTACGCTGCCGCTCGCGCACAGTA
ACACCCGTGGGCGCATATCGGATTGCCTTTTTTGTCGCTAAGAGTGATGGTCATTTGCAACTTTTAGACCTCACTTTGCCAATGGAAAAGGTGGTGCACA
CCCTTGAGCAGCGCGGACAGCAGCCAACGCCGCTTGCGGACCAAGTTACGACCCAACCTTCTTTGCTGAAGAATGTGGCGTTGCACGACTACCAACTGAC
AGGGCTACAGTGGCTGCTGCGTAAGCATGAGCAAGGACTGAACCCCATTTTAGGAGACGAAATGGGGCTGGGCAAGACGCTGCAGATTATCTCCTTCATT
GTGGCGCTGGTCGTCTCGGACCGGGAGCACAATATGGCTGAAGGAGGTAGGTACCTAATCGCCGCTCCACTGAGCGTTCTGCCCAATTGGATGGAGCAAT
TCGAGCAGTTCGCGCCCAGCATTTCGACCGTCATGTACATCGGCCCCGCGAAAGATCGGGAGGCGATACAGAAGGCCATCGAGGCCAGTCCACTGGCTCA
ACCGCTGGTGGTCGTGACATCCTATGAGATGTTGCTGTTTGACCACGATTTCTTTCACAAGACCCAATGGGAGGCGACGATAATGGACGAAGGACACAGA
TTAAAAAACCCGAAGGGCCAACTCCACGGAATCGTCTCGACCAGACTTCGCTCGAAGTACATGGCGATACTCACAGGCACTCCAATTCAGAATGACCTTC
AAGAGCTCTTCGCATTGCTGTCGATTCTGAACCCGAGCATTTTTAATGACCAGAAGCTTTTTGAAGCCACGTTCAGAGATTATTTTTCAGCCAAGGCGCA
ACGACTTGAGGAGGATCGACAGGCGAAGTCCAAGCGAGCATCCAGAGCGGAAGAGCTCATGCGTAGACTACTGGCTCCGTTACTACTGCTGCGTACGGTG
CAGGATGTTCAGGGAGCATTTACACTGCCACCGCTGTCCGAAATGGTCGTGCATACACCCATGTCGGCGATGCAACGCGCATACTACAAGGAAGTAATTG
CGAAGAATGCCGAGGTCCTGAATAGGGCAGCGAGAGCTCAAGGCAACAGGTATGCTGTACAAATTTGAAATGCACGAAGGGGGGTGGAGTCTGACGGTGT
CTACATGGTTACGTGTAGGGTCCCATTGCTGAATATTTTGCCGCAATTGCGGAAGGCATGCAACCATCCGTACTTGTTTCCTGGAGCAGAACCAGAGCCG
TTTGTGGAAGGAAGTCACTTGTACGAAAACAGTGGCAAGCTCTTCGTTCTACATCAAATTTTGCCACGATTGAAGCAAAAGGGTCATCGGGTGCTGTTGT
TTAGCCAGTCTCCACCTTTCTTAGACATTATTCAAGACTTCCTCACGCTTGAGAGCTTTGCATACGAACGCATCGACGGGTCTGTACGCGGCAAAGAGCG
TTGGCAGTGCATTGAACGCTTCAAGAAGGACCCCGAAACCTTTGTCTTTCTCATCTCCACACGAGCTGGAGGTTTGGGACTAAATTTACAGAGCGCAGAC
ACGGTCATCTTTGCGGATTCGGATTACAATCCCCAAACGGATCTCCAAGCGATAGCGCGTGCGTACCGATTGGGTCAAACCAAACCAATTCATGTGATCA
AGTTTCTATGTGCAAACACGGTGGAAGAAAGCATTTATCGACGGTCTTTGAAGAAAATGCGCATGGCCGATCGCATTCGTAACCTCGCACGCCGAACTAA
CGTCGAAGATGAAGAAACTGAAGACGATAGCGACAAGAGTTTGCTGGATCTGATCCAGTTTGGATTGCACCGACTGATGCAAGAGGCCGCCGATGAAGAC
GAAGACGCGCTGATGAAACCTTTGGAAGAGGAATACATTCAGCACATTCTGGCCCGGAAATCGCTCCAGCCAGCTGACAGGGCTACAGATTCCGACGACG
AGACAGTATCAACTGTGAAAAGCGACAAACTGCTTGAGTCGGGTGGGGATTTCCGAGAGGAGAACATGTACTACTTTGAAGGAGAAGACTACACCAAGAT
CGTGACGAACAAGGCACAAGATGCAGAGTTGCTTGAAAAATTGTGCAAGGAAACAACAAATAGCTCGAAGCGCCAGACAAAGACAGCACGAAAGCGATAT
GATCAAGATGACGACGAGGAAGAAGACGAGGGTGAGGAGAATGTTGTTGAGAATGAAGTTGAACGGGCTCGAAAACTAGAGGAGCGGCGACAAAAAGCGC
TGGAAAGGAAACTCGCCCAGTGGAAGGCCAACAAGTATACATCTGCAGCTATCGATACAGTAAAACCTGGGGATGGATCTCCGCCGTCATCACCGCGTAA
TTCTGACGACTACGGCTTATCAGGAAGCCCAGGACGACTGTACTACAAGTCTGGTGATGCCAGTCATCCTCCTCTCACGAGCTTACGCTCGCGCCCGTAC
ATTGTTGTCCATTGCGGGGATAACAGTGGTGTTTGGTGTTCACGTGGGTTTTTTCGCAGCCTATCGTCGCTGTCACCTGCTATCCAGAAGCAGTACGAAG
CGGCTGGCCGCAACGGCGATCTCAAGCTTGGTAGTGCACACTTGATGCGACTACCAGCAGCCAACAATAACTTGCCAGCCGATGGATATGTGTGCTTACT
CGTCGTACAAGGATTCATCGGGAAGAAGAAACAGCGTGTGGGTAATGGTGTCCGGCAGGGCAAGTCATCGAACTTTCGACTCAATGCCCTGGAGACTGCG
CTGCAGGCCTTAGCACATCGTGCTCTTGAGTTGAGGGCCACAGTTCATCTACCTCGTATCGGCTACGGAACTCCGAATTTCAACTGGTACGCTGTTGAGC
GTCTGCTAGCACGCAATCTTCGGGACGTGGGTGTCGAAGCAACGATATACTATTATTCACGTGGAGGTTAGTATGGTGAAGGTTAGTTTCAAAGTGGAAG
ACTTGCGTCTTCCGTCTCGACGTTTCCTGGCAACAAAAGGATAAGTCTCAGCAAGAACCAAACATAGTGTGAACCAACGAAAGGAGTCTCGGGTCTCAGT
CCACTCCTGATCACTTGTAGTGTGTCTCGAAGTCTGGGAAGCCATCAGCTGCATCGTTTTGAGACTCGATGCCGATTGCACTGAGGATGGATGTGAGTAA
TCGTCTTTCATTTTTCAGCGTTGCGATGTTTTCCTTAACATCATCGATGACGAGTTCAAGTTTTCCGATGTCATGGTTCAGCACCCTGACCGTGTACTTC
TCCTTTGAGCTGTTCGTCATCGAGCTGTTACTCGTGGCTGTGCTCAATTTCAGGCTTTTCTCTTCCCATTGCAACATCAGCAACTGAAGTTCTATAGTCA
GAGTTGCAGATTTGTTCATCGTCTCGCGAAGTTGGATCCGAGTCTTGAATTCGCACAGCAGGTTCTTGCAGCGCTCTCTGTGTGCTTGTGTGTTATGCCA
ATTTCGACAAAGGTGGTCGCGGCATGGAACCCCCTCGCTACACCTTCGCGAAATGGTTTTCATACAGTTCCTGACGCAACGTTTACCGGGAGGAGGCTTG
CAGTGAAATGCATCCACTTGTTGAATTGACATTCTCAAGCATGACTTAAAGTGTCTGACTTGTTCTAGTGCTCGCATTCCTGCGTCGCAAAGTCCTGGAA
TTGGTAGCTCAGTGTCTCCCATCGATAAAGTGTCGTTCTCCTGTTCAGGTGTGTCCGCTCGGCCAGCTAGCGCGTCCGTCACCTGATCTTCATAAGATTT
GTCTAGTACATTACCAGTATTGTGATCATCGGTGTTGAATCTTGCGTAATCGCCGTGCATGTTTCGTGTCGTCGATACCTCCGCACTTGCGACTTCTGCT
TCGCAATTCTTAGCATTATCAACACTTCTCAATGCATCGCTTGTTTGTTCCTGGCCAGAGCAATCTACCTTATTACGCCGAGTCTTCTGTCCTTTAAAAT
CACAATTCTTCACGGCAGTCACCTTTGAAGCATGTTCCAACACACGCGGGTTGGTCTTGCTTTCAAGCTCTTCCTCATTGTCAGCGACACCATTCACCTT
AGTAACCACGTCATTATCACACTTCGAGGGGGATTCATCGCGTGCTTGTTTCCCGTTTGGCGCTGTCCCCCTTTCAGACGGTTCTGAGACAATGCCAGTA
TCGGGATCATTCTCCTCGATCCCGTGTGTGTCTTGCTCTGACTCGGTCGTGTCAGTTTTTTCCGATAACTGAGCCTTCTCTCTCAGTTTTGATCGTGTCT
GGTAGCCTGCATCTCTCTTTATGGATTCACGAACACCAGAGGTACGTTTCACGAAATTCTTAAAGCTTCGTCGTGTTTTTCTACCCGTTTTGACTGTGAG
AGATTCTTGACGTGTAGATCCAGCAGCAGCACCATGACCTCGCGACTTCTTCGCCTTGCTGTCATTATCCTCACCATCTTCAAACCCGTTTACCAGTTGA
CGAAGACTTGTCATTCGGCGTGGAGTGCGTCTAACAGCTACCGCTCGCATCGACAAAGGCCGCACACTTCTTCGCTTCTTCGTCTCTTTGTCAGCTTCCT
GCTGCGTCATTCCCTCGTTGCTTCCATCCTTACCACGTCCAAACTCCGACGTCATTGATCGCTTCACTCTTTTCGATGGAGGCAGCGTCGGTGGCGAATG
GTTCTTCGTCGACAGTCTTTTCCTCGTCGCCCACTGCCTTGATTCTGTCCCAACCGTAGCAGTCACCTTCAACTCCTCGTCCGAAGCCTCGTCCATCATT
CCACGCGAGCCACTCGGTGGTGGAATAACCGGCTTCCTCGCTCTCAGCTGGCCCGTTTTGGTGTTAGCGTGCTCTGTTTCATTTCTCATTTTGCTCCCTC
GACGGATACGGAGATCTTTCGTTAACACGGAGCGCCCCATGACACCGCTGTGACAGGCGAGGATGAGGCGGTCCATTTGCTCCAAGAACCCGGGCGTTGT
GTCCATATTGCTCTCGATGAACTTAGCCAAACGACTGCAGCAGTCATAGAACACTTCATAGTCGTCCACAGCAGGAGTAATAGGAGGAAGTGTTGCTACT
TGCGTTAACTCGTCTTCAAAGGCAGCCCAAACTGCATCAACAGCCTCGGTCACAGTTCTGCGCACTGTGCGATTAAGCTGAAGTCGCAGTCGATCTACTA
TGGGTGACGTCTCCTTTGCCTCCGGCACGTGGTGGTGTGGCATTGCGTCACGTCGAGCAAATCTTGGCATCGCGCGGAATGGCGTTCTTGGAGCTGAATT
ACTGGCACTATTGTACCGCATGATACGCCAGGTTTCGCTCCTACTCGACGATTGGTTGGATTTTCTGTAAGTTGAAGTGCACTAATGACAATTGTTGGAG
CTAAGCTAAGGACTTTGACTCAGTTGCCACCAAGCACTCGCAAAGTCGAGTTAGTGAAGTCTATGTGTGCCGACCAAGTCATCGACTACACGAAGGACAA
ATGGGAAAATGTTCTGGCATCACATTCGGTGGACGTTTTGTACGACTGTGGAGTGGTGCCCTCGTCCTGGGACGGCGGTGCACAGTAAGTGCTACAGAAG
AACACGGATCATTTTACTCGTTGGAACCGATGCCTGAACCTACCAAGGAAGCTGAACTCGGTGCGAAGCTTATTGGTCTTGTCAGCTCCGACGATAAGTC
CGCGGAAACACTCAGAGTGATCACGGAGTATATTGAAAGTGGGAAGGCAATGCCTATGATTGATACAGTGTATCCGTTCGAAAAAACACTTGATGCGTAC
GCGAAGCTGAAAAGTGTCACGCACAAGAAAAGTTCGTGGTTCAAGTGCAACCTAAGCGTGCTCGCATGGTCACAAACATCCTTGAAAGCGAAAGTCTGAA
ATTTGCTAGCCCCCCCCCCCACCACTCAAAGTTTCATAACTTAATGCTCGCAATGGTTTGCCCTGAACTTCGAAGTGTTTCCTTAGTTTTGTTATGCTCT
CATTCAATGGGTCTCAAACCATATTCCTCAAGGGTTTACCTCAACAACGAGCTTGCCCCGCGCGTGGTATGTCTTCAGCTTAGCATAGGCATCCAACACC
TTCTCAAACGGATACACCGTGTCAATAATGGGCTTGACTTTTCCGCTCTCGATGTACTTCGTGATGGTAGCGAGCTTTTCAGCCGACGGATCAGTGTTGT
GGACCTCGCCAACAAGCTGTGCACCAAATTCGGATTCTTTCACGGGTTTCGTCATAGGAAGGATCGTGATAAATCGGCCCGTAGTCTTTTTTAGTACACG
TTGCGCGCCATCATTTTAAGCCGAAGGCTCCATGCCGCAGTCGTATACAGCATCTATCGAGTGCGGTTCGAGGACGTCCACCCACTTTTCCTTTGTGTAG
TCAATGATTTGGTCAGCACCGAGCGATCCCACCAACTCGACGTTCCGCGAGCTCGTCGTTGTAACCACACGGACCCCCAAAGCATGTGCAAATTGTATGG
CAAACATTCCAACGCAGCTGCTGCCGCCAAGAATGAGCACAGTATCACCCAGCTGAAGCTTCGCATGCCTCACCATACCGGCATACGCTGTGAGTGCTAC
TGAAGGCACTGCAGCTGCTTCTTTGAAGTCCAAGGTTTTGGGCTTTAATGCTACATAGTCCTCGTCCAAGACAAGATACTCAGCCAGCGTGCCAAACGCG
GTGAATGGTGTCATGGCGTAGATGGCGTCGCCAACTTTTAGGCGTTTAGCGGCAGTACCGATCTCAACTACCTCACCAGAGCAATCGCAGCCGATGTTGA
AGGGCTGGCGATCCGACGGAGCTTTTCCAAGAAATATTTGGCCGAGACCTTCCATCACCATGCGGTCGATGGCGTTCACTGCAGCATCGCGGACCTTGAT
GCGCACTTGTTGTGGACCCAACTCGGCCTGCGGGATGCCATCATGCAGCTTGAGCTCGTTCGCGAGCGATCCGTAGTTCTCGTACTGGTACGCGCGATAG
GTCTTCGGAAATGACATTGCTTCTAACTCGTCATCCATCCGGAGAGAGAAATGAAAAGTGAGAATGGAACAACTGCATTCTCAGGTGAATTCGTAATCGA
ACGCCGTTGTTGGCAGAGTGAATGACGCTTACAGTACAAACACAATCAGCTTGTTGATGCTGACATTTACCCGGTACACTGTAGTACAGTGCATGACTGT
ACTGCCAGGTAGAAAGAAAAAGTATCTTACTGTACATGTATTGCACTTCTACCCCACGTAAATTACCGCCTGAGAGGATTACGTCGTAATCCTCTCAGGC
GGTACCACGTAATCCCCTCAGGCGGTCAAGCTGAGGGGACGACATGTACGGTACGTGTATTTGGCTATCATTAGCCTCAAGCAGGGGCAATGGTAAATAT
CATATTATATATATACTAAATTTATGGATATAGTACTACTTCCGATACTAATTTATAATAGTAAGTCCATTTTTTGGAAATTTTAATAATAACTCAGATA
TTCGAGAAATATTGGATGCTTGTTAATATTTTATTAAATTTCCCCCCTTAAGTACGTTTCTTACCAAAGAACTCTTTCAGCTCTACAGTAAACAGCAGTA
GTGATGACAGGCTTCAAAACTGACGAGTATACGGTTGCATTTGTTGAAACTGATAGAGCGAAATCAAGGTATTTGTTCTTGTTCTCTGCCGATAGCCTCG
TCCACATCGTGCGTCTCATAAACCTGCAAGCTGTGACGGTAGAGTAATGCGCTCAGCAGGGCCAACACACCACACCAACCTTGCCGTCACGATCATAGAT
GTGAGTCATTTTGTCTTCGTCCAAGTGGTGATATTTTTCGTACCATACCTATTGTATTGCAGCCAATTTATTTTTTCCAATCATTAAAACAGAAATCGAT
TCTGACAGGTTGCAAGTTATACTTGTATTAAACACTGTTGCTGTCAGCAACTTCGAACTGTCGTTTCTGTGCAAGAGCCATCTGCTTTCTGGCTTATTGC
TGCACTTTCACCACCAACTTTCCGTGTCAATCACAGGTTTTACCTCTTTGGCCTCGATGTACTTGGTGATAGAGGCGAGATTGCCAGCAGATGGATGCAC
GTGAACCTCACCGATTAAATGTGCACCAAACTCAGCTTCCTTTATCGGCTGCGCCATGGGCAGGATCGTGATAGTGTTCTGCTTCAACATGACTTGAGCA
CCCTCGTTCCATGCAGCATTCTCCACGCCGCAGTTATAGAATGCATCCACAGAGTGCGCCTCCACTTCATCCAGCCACTTTTCTTTTTGGTAGTCAATGG
CCTGGTGAGCTCCCAGAGACTTGACAAACTCTGTTAACAGTCGTTATCACACGCGCCCCGATGGCTCGTGCAAACTGAATCGCATACATTCCGACTGAGC
TACTACCCCCTAGAATGAGGACAGTCTCGCCCTTCTGCAGCTTGGCGTGTTCGAACATACCTTGATAGGCAGTCAGGGCAACAAGCGGAGCGGACGCAGC
CTCGTCAAAGCTGAGGTTGCGGGGCTTTGTCGCTACGAACTGCTCGTCCACTACAGAGAACTCGCCAAGCGTGCCGAACGCGCTGAACGGTGTCATGGCA
TAGACCTCGTCACCGACCTTCAGGCGCTTGACGTCCTTGCCGACTTCTACAATCTCGCCCGCCGCGTCGAAGCCAATGCCAAAGGGCTCAGTTGCAGAGG
GGGTCTTGCCTAAGAACAACTGGCCCACAGCCTCCAGAAGCATGTAATCAATGGGGTTCACGGAAGCGCTGTGAACTCTGATACGAACTTGCTCTGCGCC
GAGTTTCTTCTGAGGGACATTGCTTTGAAGCTTCAACTCTCTGTCGAGCGGCCCGTAGTTCTCGTACTGGTAGGCGCGGAAGGTCTGCGGAAACGCCATG
GTTTGATAAGGTCGTTGAGGTACCTGGTCTTGCTTGCGACACGAAAAATGATACACGGCGAGTCGCCGGCGGCGACATGGTTTAAGACATGATACCTTCA
AACCAGAGAGACCCATGCGCTACCTTCCTGTCGACCTCCACACATGTAATCAGACCCCTCCATAATCACACAGACCTGATAATCTTGAAAATTTTGTCCA
ATCAGTGTCGTTTGGTGCGAAACGACACAACTCTTCGCCAAGTGACCATGTCGGACGCGGATCCGGACGATGACTATGCGAGCGACGAATACGAGCCCGA
GTCTCCCGCATGCCCTCAATCACCTCAAACACAGTCACAGCATCTCCCAAGTTCATCGCCCGTTACTGCACAGTCGCAACCGACGCTTCAATTGGACACG
AACCTTCCGGACGATGAGAGCGAATCTGGAGCTGTCACGCCAGTACCTAAGGAGGGATCCAAGCGCGCACGAACCTCTCGCGAGTCAAACTCCGTTAGTG
GCCGTCGCTTAATGGATAATACCGCATGGACGTACACCGTCTCGGCGTTGCAGGTCCGTATGCTGCGAATTCCAGTGGTCGACTCTGCAACGATCAGAGA
GCTGCGGGTGTTTGCGACGATCGACAAACAAGCCGCTCAATCGCGAGGATCGAGATGGAAACAAGAGTTTCAGTCAGTTGGACGATCACCTCAGCGGTCG
ACTAGGAAGCGAGGACAACGAAACAAATCACTGAGGAGGGTGGAGCCGTATCGACGCAGTGGACTGATCGAAGAGGCCAAGTGGACACGCGGTGAAGGGA
AGCTGCAATGGACTTTTCCAATGGAGAAATTTCGTCATCTGAAGGCGTATGCTCCGAGGGTTAAGGCGTTTGTGTACGGTATTGGAGAGGCCGGAGTGGT
GAACCCTTGCCGAGCGCAGATCGAGAATCTCGCTCGTCAAGAGAAAGAAGGAGCGATTTTGAGCTTTGGATGGTTCTTTCTCGATCTAAGGTTCGTTAAT
TTGTTTTAAATTGACATGTCCACCAGTACACTAATCTCAACATACACTTTATGCGCGTTAAGGACCCCAGACCTCCCAGAACGGTGGCTCAAACTGCAAA
ACTCACCTTTTGGTGGTGAGATTTTGATCTCCAGCACTTTTTTGCCGGTAGAACTATCGCCTGCACGATCGGTAAACAAATCCGTGACACGGTTTGAAGA
TAATGTGAGAGCAGAGGCCAAAGCAGTGGCAGTCGACGAAGCGGGAGCAATACCAACTGTGGTTTCAGGCGAAAGTGGAGAATATTTGCAGATTGGAGAC
GGAACTGGTCAAGACATTTTTGTGCTGTCTGTCTTCATCCAGGCAGCTTCTAACCTGCTGAAGGTTGTAGAAACCTCAGTGGGTGAGAACAGACAGGCAT
TGGAGGAGACGGGATTCTGGCTCAGCTATTCTCTGTTCGATGTGGTAGTCCAGACTGGTATTTTCCATAACCTGAGTGTTGCCGAGTTTTCGCCCATTCG
CGATAGTTTCCGCGTGAAGACCAGCTTGAAGGATCTAGCACTCTGTCTCGAGGCTTTAGGGACCCTTTCGGTGTTTTTGTGCTCAGAAAACCGGGTCCTA
GCTGGAGTAGAGATTCCGTTGCACCTACTCCTGTCAAAAGGGTTCTTTGCAGAAGGGAGGAACAAGCCGAAACCGGGCGACACTGTTGACGTTGATGGCA
AGTTTTCGTTCCCTGACTTCAAAGAAGCCATTATCTCTGCTTCCGTTGCTGTTGAACTCGTGGAATCCAAAGATACCAAAACCCAAGGAGATCGTTTGGT
GAATAAGTCCGAACAAAGACCAGAAGCTGAAGTACTGACCCAAGAAATCACAACATTTGACGATGAAACTATACTCGCTGAAGGTGAAGTGGATGCGGCT
TCTGAGGTTATATTCAAATTGGACCATGTGCGTTTGAAAACGTCAGCAATTGAGCAGTTTGTTGGTGAAGAAAATGTACGCATTGAGGTGGTTACTGGAG
CAGAAAACGTGTCTAGCGAGTTGAAGTTTTGTTCTTACACCAAACACCAAGCATTTGCTACGTGTGGGGATCTTACGGTGGGTTTTGGTCAAATTTCACA
ACAAGGTGCTCTAGATACACCTATTAGTATCCGATGTTTGTCATCAGTTTCCAATCACTTGGTTGCGTCATCGTCAGCGTCCGCCGAGGTCATTCAGGAC
GATGAAGGTTATCCCAGATCTATTGCTTACACCATGCTGAATGAGTCCAAGCAAGTTGTGGGGCAGTGCACGTTAATCTGCACACGTAGATCTGATGCTC
ATGAACGTGAAGTAGTAGGTGATGCAAGCCAAGACGTGCGCCGCTATCGGTTATGTCTCAAGCTGAAATCCGTCCGAGATTTTGAGATGACTGGAGGATA
TTCGCTGCGGTACCAGAACCCATTTCTCAGCTCAGCGATGGGTATGTATTGACGTTTGCTGCTGGTTAGTATGACAGATGATTGACTTGTTATTTTGATT
TTGTGTAGTCACCAGTGACTGGTTCACTGTAAAGGACAAGGGAGAGCTGGAGTCTATGAATTTTTATTGTATGTTCGACTTAGCGAAGAACCCGCTTCAG
CTCAAGCAAGAAATGCAAGAGTCTGTCAGAATCGACCTGGTCTGTTATGATGAAGAAACGTAAGCTCTCGAATCATTTCTCGGAATATTAAACCTCGTGG
TTATACTCACTGTTCGTGCTATGTGTAGGGTCGGAAGTGCCGTCTTCAGTTTGAGCTACTTGTATTTTTCGGAAGCGCATTTCTGCTGTTCTGAAGACAA
CTGTGCTGAGATTTTCATGACTCAAACCGACGCAGAAGCTCACTGGCTTGACGTTCACACTGAGTCAAAACTACCTGACACTCACCTTGGACCAGAGGCG
TACTCGCACTCGTATCGCAGTTGCTCGATCAACATTCCAATCATCCGTGTTGGTAACGGTAGTGGGTCAACAATGCAACAACAGCATCGTGTGGGTTCCG
TCCGTGTTTCAGCATTTTTGGAGGATACTGGAGTGCAGCGTGCAGCACAGAGCGCAGTGTACGTTGTGCTGGTAATATTGTGAGTTGTAAGAAGGCCCAT
GACGAATACTTGCTTGCTTGTATGTAGGCTTACTCTTGCTCCCCCTTCAGTGCAAGAAAAAATGACCATTCAAGAAATGCCAGATGAATCTCAGTTAGAC
ATGGATGGTTCTACCAGAACGATGCGAGAGCGATCAGCTAGTACGTCTGTCTTACGAGAAGCTGAAGAAACGACTCGCTTGGCGTCGGCAACTAAATCCT
CTCCAATGGTTGAAGTGTCTTCTCCTAATCCTCACGAAGAGGAGAGAGCAAGGCAACTACGTGATCGAGAAAAAGAGATAGCGCAACTCAAGGAGGCCTT
AGAGCGAGAAAGGAGTGCGTGGAAACAAGAGCAGCACCTTCAGCAGTTGCAATGGAAACGGCGCTTTGCAGAGATGGAAAAAGCGAGAATGGACGAGCTC
GAGGAGGAATGGGCACGTCGTGAAGAAGAGCGGAGCAACTTACTGAATTTAGCGCAGGAAGAATATCAGCGCCTCGAACAAACGCTACGGAAATCTTTGG
CCGATTTGGAGACGAGAGAGCGTCGCTTAGCTGTGGCCGAGTCTTCTTTGCAGCGAGAACAGGAGGCTAAACGAGACGAGAACGACTCTCTACAGCGGCG
TTTAAAGAGTGAGCAAAACCACACATTGTCATTAGCGAAGAAGCAGACAGAAGCTTATGAGCGACGCATCGCTCTACTGGAGTCTCAGCTTAGTGACGCC
GAAAGTCGTGCCAAGCAAGTTGAAGCCGATTTTACAGAGTACCGTCAACAGCAACGGAAACTTCCCGAGTCCAAACTTCGAGAAGAGATTGCAGCACTCA
AGGGAAATGTATCAGAGCTAGAAAAGCAGAAAATGGCGAAAGATCGGGAGTGCGAGATCGCTCAAGCGAATGTCGAGAAGATGAAAACCCAGTTGGATCA
AATGACGAGCTTATTGACCCGAGAGAAGAAGAAACACGAAGCACGGGTGGTGGATGAGCTGGAGAAGCTTCGTGTCAAGTACATTGCTCGAGAGGAAAAA
TACGTTTTGGATGGAGATCGAGACGAACTTCGAGCGATCAAGAAGCAGTTGGACGACTTAAAGGGGTTTAAGCTGAGGAGCAACAGTGAGAAGAAACGCT
CCCATAGACAGCGCTCACATGAGTCCACTTCACCGCCACAACACCGCAATCAGTGGCACACGCAGAGTCGTCAGACTGCATGTGTACATCACGCTCACTC
ATCAAGTCACCCAGGATCGAGTTTCCACTCTGATAGCGCGTATGGACATGCAAGCGACTGGGAGCCATACGAAGAATCTAGACGTGCAGACACAACCCCG
CAGTTGGATCTTCACGAGTCACGGGGCGAACGCGAGTCCTTAATCTATCACCAGGGGGGCTCACTAGCGACGGACAAAGCCGACACAGACCAAGGACAAA
GAGCGTTAGAAAATTCAGACGATACCTTCGTCGGACCACTGGACACTGAGCTAGGTCGTCTACAACGCGAGCGGAAGTTGTTGCTGGCTAGTGGGGTATA
CGATGCCCAAAGCTACCTGGTACGCGAGCTCGACCGACTCATCAGCGTCACGATATCAAATGCTGACCACCAAAGGCAGTAGCGTACAGTAGATAGACAT
GATTTCTGCTATTGCCGTGATGAACTTTGGGCTGTATTTCGGGTTTGGCTTTCATGACGGCAAAACTCTACTCATCTGGTTCTTATACTTTTCAAAGGCC
TGGTTCAGCACCGTGAAAAGCACTTTCGCCTCCAGTTGCTCGGGCACCGTAGCTCCTCGTAATTTGTCGGGGTGAACAACGCGAATGATGTTCCTATACA
GATAAAACAACACCCCGTAAGCGACAACAATAAGGACGATCCACAGCATCGCTGGACTCACCGGTAGGCCTTACGCACTGTATCATCGTCAGGAGATTGT
ACCACCATCAGTTGGCATTTCTTAAGCGCATCATTCGATGAGATTTGGTCCAACGTGAGAATCATGTGCAATAGTTCTTTGCCAAACGCCCACATCTCCA
CACGTCGATGAATATCTCCCCGAACAGCGTCAGCTTCATCAGCCTCAAGCTTCTTCTTCATCTGCAACTCATGGCGTTCGCGCAAACGCGCTTGTTGGCG
AAGATACAGCTCTGTGTCCGCCATCGTAGGCTCGGGAGGTAGCGGTGGCGCCTCAGTCGATGGCGTTCGCTCTTCCTCCGCCTCACTTTCTGACGTCTTG
CTCTCACTCTTCCGTCTAACGTTACGACGAGGCTGGCCATCAACATCCACACTGTCATCTCCGTGCGGTCGCGGCGGGTCATTCGGTTGAGGTGGCGAGG
ATACTTGAGGCTCTTTCTGATGCTGCTTGCTATTCATCTGCTGTCGCATCTGTGAAACACGAACCGTTTTCATACTGGCCGGTCGTCTTCTCCCATTTCG
CCGCGCTTGCTGCTGCTTCCGTTTCCGTTCGCGTTCCTCTTGAGCCATCTTTTCCCATTCCTTTTCGTACTCTTCCTTCTTTTTCGTCTCTTCGTGCTCC
TTTTCTTGCTTGCGCTTCAGTTTCTCATTGCGCTTCTTCGCTCGAGCCTCCATGTAGTCATTCATGCGACTCTTGCTTGCGCTATGCGAGTTGTCACCTC
CACTCAAGCTTCGCTTCTTTTCTCGACTTTTGGAAGACGTAGGCGAGCGAGACGAACGCTTGTCGTGGCGATCTTGGCCCGGTAAACTGCTCTTACGAAC
TTTCCTGTGAACCTCAGTCTTGATTTCGACTGTGCTAGCGTCTTCGTCCGATGAAGATGAATCGGATGAAGAAGACGACTCTGACAGACTGTCGACCTTC
TTGGCATCCACGTGAAGAGGCTGGCTCTTTTCCACATCAGGCTCGTCAGCGTCGTCGTCTGAAGAGGACGAGAAAGATGAAGAAGACGAGGAAACTCTAC
TGAAAGACGGCGATTCTCCAGGCGTTTCGACGCGTCCCCGTGTCTCCATAGGATCAGCAAACCGTGTTGGTAACTGGGTCGGCTTGTCAGACGCCTCACG
CAGCTGTTGACTTTCAACGCCATCGTCTTCTGATTCACTTAAGCTGCTTGAATCCGCGTCGGCTCCTGCATCGGATTGAATCAGTTGCGACGGTATATCC
ACATGGACCGGGGAGGCAAAAGGCGGAGGCGCCTCGTGCACAGAAAGTGGAGGAGGGGGAGGTGGCGGTGGCATGTCTTCGTCCGATGAATCGCTTGAGG
ATGACTCGCTGCCAAAAATGCTATCGCTGGACTCGTCTTCATGATGCGACGGAGACTTTGCCACGTACATACGAGGACGCTCCTTCAACACCTTGCTATG
AGCGAATCCTTGACGCGGAGGAAGCGGTGACGAAAACCCAGCTTCACCTGTCGTCGCTCCTTCGGCTGCCTCGTCTTCAGCTTTAGCCAAATTCACCCCG
TTCCGAGGAGACGAAACTCGTTTGAATCTAGAGGAAAGCTTCTCAAAGAAAGTCACGGACGTGTTAGCGGACTTACCATTAACCGTGGTAG