Description :
From Genome Similarity Track
Location :
Scaffold_77:19534- 23372
Transcript NameFunction/comments
Phyke_g3242hypothetical protein
Phyke_g3243hypothetical protein

Sequence
3838 bases(100 bases per row)
GTAGGCTGCAGCGAGACGCTCACACACGCAAAGCGTTGGCCCGTGGCATGAGGCAAATCCGCAGCACTGAATTGTGCGGTGCTAACGTTATTAACGCCTG
GGCCGACGGTGTCACTCGGGAAGTTCTCCAatgccatcgtcatctcaTCCTCCTTGTAAATGGCAAAGCGACTGCAGTCCTGACCATCCTGCAACCCGGC
AGTTTTCTCTACTGCACAGACTTGCCGGAACAAATTCAGCGCGTCGTCAATGTTGCGGAATTTGCCGAACACACGGAAGCGAGTGAATTCCATGCGACTT
ACTtcagtcgcagcagcagcagctttacGTAGCtggtcaacagcagcttttccagGCTTCACGAGTTTCATGGAGGACAGGGAAAAGGACATGCCCCTGG
AAGCAGGACGAGCAGGTGTCTCTCTCATGAACCCCAGCACGGCAAACGGCTGACACACTCCGTGCACGGGGTCCCAGATCGAagctgcgcttgctgcgGC
GCCGGAAGTCGCTCCTGCAGGTCCGTTCTTAGACGCATTTATAATACTCTCGATTTTGTCCGTGCGAATACGTCCACAATGACGCAAGTCACTACGATAT
TCCTTCGAGGTTTGGGGCAACTCTGCCCCTTTGATCGGAGACACAGCAGGCAGTGTCACCGTGAGAGATTTCTTATCGGCAGAGTTACCACCGTCTAAGT
TGGATCGGCGATGTGGTAGTGTATTGACTCCAGTTGCACGTGAAGATGTTTGCGTGGAGGCGCCATTCTCTATGTCCAGCATCGTATTTGCTCGATTGGC
CCCATGAATCGACTGAAGTGTGATCATCTTTGCTGTAGCTTTCCTCTTCAGTACCAGAGGGCCAGAAGCAGATCTGTTCATGTTTGTCTGCAGATTCAAC
ATGTCGCGGGAATCCTGCGGCAGTGAAGAGTGTCGACTCTTGACGGGGTTCTCGGCTCGATGATCCCggtcttgagcttcttccatcCCCAACGTTGTGT
CACGATTGTCGCGAGATGTATGCTGGGAACTGGTTGCTTGGTGAATAGGATCTGGACTACCATTTGCATGCCGCAATGCGCCCGAAGTGCCTAGCTTCGC
AGCTTGTTTTCGGCGCTCAAGCATGAAAGATCCAGGATCCACCAGTGTGCGAGGGGCATCACTAACCGGCAGCAGTGGGGCAGATTGAGATTTTGCTAGC
ACAACATTTTCGTTGATAGAAACGGTGCCTTTACCTGAGTGCCCCCCAGCAGACCCAAACAACTGGTGGTGATTTTCAGCCATGACGCCGCTGATGAAGG
TTTTCTTGTATTTCTCCCACGCAACTGATTTGAGTGCACGACTCTGGATGGATTCGCAGATATACCCGTTTGATGAACGCTGCAGACTAGCGCGAGCCTC
TGGTGACATCAGGTGGAAGATGTCAAACCGTGATAACACAAGAATTTTCATCGGAGACTCCGCTAATATCGAGTAGTCGCGGACGAAGATGTCGTTAAAC
CTCCCTGCCGATGCCCTGGAGATAGCAAAGCGAGTCAGTGCCAGACAATGGGAGGCCATGCACATGTGATTCTGAATTCGATGCTTACTCTGCGCAGCCT
AAGACTGAATTTGGGCCAAATCTGCCCAGTTCGTACATTTGCCGCTGGCCAGTTATGGGGTGCTTACCCTCGTGAATAATCCGGCACTCTCCTCGAGTta
cgatgaagagctccgtTGCGCGTGATCCCTACAGCAAGACAAGTGCTCAAGTTATTCGTAGTTGTCCAAAGGAGTCAAAGCTTCACAGAGAATTCGCAGT
TGACCTGTTTGCAGATTTCGCTTTTGAAGGGAATGTACTTTTCCGTCATCACGGAGCACATGCCTTCGATAGTGTTGTCGTCCCATTCAGGGCCAATGAA
GTACGGATTCTTTCGCAGCATCTGTGCATACTGTGCGTGATACTCGTTCTGGTACTTTTTGATCAGCGGTTCGTACTCTTCGCGACCTAGTATGAGCAAC
TCGCAAAATTCGGTGCACAACACCGTGGCACGACGAACGCCATCAGCCTGTGATAGCGCTAATTCACCGAAGTAGTCCCCCTCACCGAGTCGTGACACGA
CATTCtctgttgtttcttcaaaACGGTTCTTCCCACGAACAGAAACATCGACACAACCGGTGAAAATGATGTAAAAATGCCGCCCTATTTGACCTTCCGC
AAAAAGCACGGTATTGGTGACGCTGCTTATGAGTCGAAGGACCTTGCAGAGTTGCTTGCGGACCTCAAACGAGAAACGGGAGAAGAATTTGACGCTTTTC
AGGTACTCCACGGCGAATTTAAGGTCCTTCTCGGACCGCTGAGCCGAGCTTCGCATGAAGATATTGCGCACGATATCTTTATTGCTCCGGAACCTCTTCG
TTATCTCGAGTGTGTGGGTACTTGAGTCGTGTGATTCCTTGAGTAGTTCACTGAATACGACGCGATTGATGAAGACCAGCTCTGTCGGGGCACTCGCAAC
CAACACGGATGCTGATTCCCACACATCATAAGTAAGTATCCACAAGATAACTACCAAAATCATTCACGACATCTGCACGATAGCCACACCTGCGCGCACA
TCGTTATTAGAGAGTAGAGCCCGTTCCCCGAATGTATCTCCAGGCCCAAGGAACACTATATGGACGGTTCCATTGGGGCGAGCGGGGTTGTTGACCTCGT
TTTTCACCACTTCCACTACGCCCAACAACATCAGATCCATTTAAATTAAAACCCACGGCCAGCACCAGTATTAGTGTTGGATAGCTTACCACGGCCTGAA
TAGACAAGGTAGAAGCTGTCGCCATCATCGCCCTTCACGCAGAGATCAAAAAGCGGGTATCGTTGGTGTTGCACAAAACTACTAAAAAAGCACAATGGGG
AGACACACCTCGTGGAAAATGAACTCCCCTTTCTCAGTAAATTGCTTTGTCTCGAGAGATTGATAAAGTCGATCAAGCTGCGGTGACACGAACGGTGATC
AGTCACTGCGGTAGCCGATGAATATGAACGCAATGCACGGGCTGTGTACCTTAACTGGCAGCGCAGAGAACAACAAACGCGTCAGCTATGGCGTGAGTac
tcagcagcaatgatTACTGTCCACATCCATACGCACAGGCATCGAGGTTGGtgaagaactggagcagTTTGGACGACGCAAAAAGTGACTTGAGCTGAGC
ATCACATGTTGTAGTGCACTGGTGTTAAAGATACTTCCCACAGATTCTGACTCTAAAGAGCCTATTGCTGCCAAGTGACTCACCACATGAATATCCTCCA
GAGTGCGTTTCCCAGTGGGTTTGCGCAGAATGGTGCGGCACAGTTCCACCTGCGGACTCTTCTGCTCAATGGCTCGAAAGAACGCGCCGTCGCTAGccat
ctcctccatctgcgATGCCAGAGACCTGCGTCTATTGGCCGGCGAGTCTTCATTGGTCGTAGCTGTAGCAGCATCGCTGTACTCCATGGTGTCACAAGCG
TTAGTCTACACTACACGACAGTAGCTGCTACCCCGTAGTGCTCTTAAGAGTATTCTCGTACGTACTTGAAGGCGAAAATAAACCGTCACACAATGTGTAG
CCATgtaaatgtagccatcttgtCATGTCCATCACGTTGCACGATTTACTCTAATTAGTAGTGAATAAATTATTTCATAGTGAATTCTGATAATTCTTAT
CTACTGAGGGTTCTCTCTTAACGCGACAAATGATAGACGGCCCAGCATGGGTCGAGGAGACCTTGCGGCGGGTCCGTTCGCACTTCGCCAGCGATCGTTC
CGTGTCTCTGTATGAGTCTCTGACTGCCCATGTGCTAG