Description :
From Genome Similarity Track
Location :
Scaffold_3693:1953- 2991
Sequence
1038 bases(100 bases per row)
CGGAAAGCACTGGGCCGACACTGTACTCTGCAGGGTCGATAGCCGTTAGTGTGGACAGAACGGATCTCTCTACAGCACCAGAAAACATTGTTGATTCCCC
GGCTTTCAGCCTGCCCGCGGCATCTATTAGAATCCAGTAACTCGGTTTTCTTCATGTGCGAGTACTGTGCAGTACTGTATGCAAGAACAGGGTGTATTTT
GAATAAATCGCCGTCCTTGCCCTTATGGATACTGGGAAGGTCCGGTTAATCAACCATGATAGAGGGGGGTGTAGTTACCGTCACAACATCCTAGATGTAA
CGCTTCACTGTCTGTCATTATATGACAGGTTAGTGTACAGGATTTGNNNNNNNNNNCTTTGCATGCTTCAGGTTAAGTGCGATTGGGAGATTATAGTAAA
ACGAAGTAAAATATAAAGTCTACAGGTCCAAGAAAGAATGAAGCACTGCCAGTAGCCACTATTGATACCAAGGAGAAGAGCCTCCACGACACGTGATNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAATAGAGGGGGGCGTCACAACATCCTAGATGTGGCGCTTCACTATCGGTCATTATATAACAGGTTAGTGTACAGGATTTGGTGGAAATCTGGGACA
GCGCAATGTGGCGAGGCTCAAGAACCGGCGGATGACAACTAGTCTGTCTCACCACGGCCGCCATCGCTGTGGAGTAAATTTTCCGCTGGTTATGATGGCC
GTGAATGTTACTGCTTGCTGAGCCGGAGTGAGCCAGTT