Description :
From Genome Similarity Track
Location :
Scaffold_15:195233- 212836
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08040acetyl-coenzyme A synthetase
Phypa_INRA-310PPTG_08041hypothetical protein
Phypa_INRA-310PPTG_08042mono-ADP-ribosyltransferase sirtuin-6-like protein
Phypa_INRA-310PPTG_08043myosin-like protein
Phypa_INRA-310PPTG_08044hypothetical protein

Sequence
17603 bases(100 bases per row)
TCATTGCCGTTCTCGTCAGTAACCACGAAATCAATGCCAAAGAACGGCTTGGTGCACGAACCAGGCTTCATCGGAGTAGCTCCAGGTAGGCCGACACCAA
TGTGTCCGCCGGTCTCGGTCTGCCAGTAAGTGTCAGCGATGTAGCACTGGCGGTTACCGACAACTTCGTAGTACCATTTCCACGCCTCCGGGTTAATTGG
TTCACCGACACTGCCGAGGATCTTCAAGCTGGACAAGTCGTACTCCTTGATCTTATCGTTGCCACGAGCCATCAACGCACGGATAGCGGTCGGAGCAGTG
TAGAACTTGGTCACCTTGTAACGCTGGATCAGATCCCAGTAGCGGCCATGGTCCGGGTACATCGGTGTACTCTCGAACATGAGCGTGGTGACACCATTCG
CCAGTGGACCATAGATAATGTAGCTGTGGCCAGTGATCCACCCAGCGTCAGCCACACAAGCGTAGATGTCATCAGGCTGCAGGTCGAACGTGTACTTGCA
CGTGATCATAGCGTACAACAGATACCCGGCCGTCGTGTGGGCAATACCCTTGGGAGCTCCAGTGGATCCAGACGTATACAGGATGAACATGAGATCTTCA
GCGTTCATGAACTCTGCAGCGCAGTACGGACGGTGGCGCTTCATCTCCTCGTCCATATCCACATCGATCTTGGGGTTCATCTTCACCTCTGGGTTGTGAG
TACGCTTGAACACAAACACGTTGCGTACAAAGTCCAGGCCGTCCACTGCAACGTCGACAATCTGCTTGAGTGGGAGCGTACGGCCGCCACGCTTGCCCTC
GTCTGAGGTGAAGACCCAGTGGGTGTTTGCGTCAATAAGACGGTCACGCAGAGCGTCGGCCGAGAAGCCAGCGAATACGACGCTGTGTACGGCGCCGATA
CGCGTACAGGCCAGCATAACGAAGGCGATCTCCGGGATCATTGGCATGTAGATGGCCACAGTGTCGCCCTTCTTGACACCAGCGTGCTTCATGGCGTTGG
CCACGCGGCACGTCTCCTCCAGCAGCTCCGTGTAGGTGATTTCTCGACCTTGGCCGATCTCGTCTGCCTCCCAGATGATGGCCACCTTGTCCGCGTGCTT
CTTGACATGACGGTCGATGCAGTTGACGCTCACATTGAGTTGGCCATTGAGGAACCAGGCCACATCGCCCTTGTTGACGGTGCCCACAACGCTCTGGTCG
AAGTCGCGGAACCAGTCGAGGTTCTCGCGGGCCAGCTCACCCCAGAAATTCTCCGGATCCTCGAGCGAGCGCTTGTACATGGCCTCATATTGCTCGAAGT
TCTTGATGTGGGCCGTCTTGGCCAGCTCCTGGATCGGAGGATATTGTCCGTTAACGCTGACGCCGGCACTGTCGCCCATGGCTAATTGTGTGTTGGGTTT
GGAGCGAGAGACTTGAGGTGGTAGGGCGCTGTGCGCTTGACGAGGCAAATTGGATTGTGCGGTTGGCCAGCGACTTAGCAGCACCGACGCCTTCTTCAGA
ATCTTGCTTTACCTGTCCTTGTACTTCATGTTGTTGCTGTGCGATCCCATCTTTGATTTGTGAATACGGACACTGAATTTAGTGTATCAAGTACAAAAAA
CGTTTTATTGACCTCTGTTTAACTTCTCTAGTTCTTATGTCGATAAAAACACCGCACCACCGTCGAAAAGCTTGCGTTTCACACCAGCCGTTAAAACGAA
TAAGCTTGGATAAAGTAGGCTCCTCAGTAAGTGCGAATTCTAGTGTTGCTTAGTATTCGCTTGACACGCAAGGCAATATTGCGTCGCGAGCTAAAGCCGC
TGATTGACCGCCGAAACAGCAAGTTGTCGTCGACTTCAACTTGACCCGGGGCGGTTCTTGTGCCAAAGTCTTTTTCTTTTGTTCATCCTGAGGTCATAGG
ACTCGTAGTAGGAGCTCCAACGTGGCCGCTACCGTGCAAACTGCACGGCTGAAGCAATCAAAAATGAATTGTTGATTAATTACGGGCTGATCCCATGCGG
TCGTCAACGAGTAACCCATTCGTCGCTCCTTTCGAACGAGGATGGCCACGTTGAAGTTTCTTGCCGTGGCAACCGATTTGCACAGCCCTGACCATACTGT
AGCGCTACAAGGAGACTACGTGCGTTGTATGACATGCACTGCCGTTGAAGCCTCGCTATTCCTAGCACAGCAAGAAGCGGTATTCATGTGAAATGCATGT
TTAACCAGATGAGATTATGGTGGCAATTATGGTGTCTTGAAGCCAGTGCCTTCTCACGTCGAAGTCAAACCACGGCTCCGCAAGTTGTGAGCGACGTTCC
TCCTTTGAAGTCTTCCATCGGTGCTGGACCACCACAACTTGTGGCACAAGGACGCTTGCAGTGGATGAGTGACCCCAGCGGCGATGCCAACCTTAGTAGC
GTTTCAGGTGATGACTTGGCGACGGAGCTCGTTGAAGTTGTCTTCTTCGAGCCGAGTTAAACCAGCAGAAAAAGTGATCAGATTGTACCAACTGTGGGAC
CATCTGCCCTTTTTTCTCGTGGGTATTTTGCACGTTGAACTAAACCGTTCCGTCAGCCAATCAGCGATGGCCGAGGATAGTCTCCACAGACAAAATGGTC
ATTTAAGAATTTGCTTCGGCCGACTCAAGTCTCTTCGCCTTTTAATTGGTCAAGCGGTTGTGAGCATGGGAGATAGCGCCGGTGTGAGCTTCAACGGGGT
GTATCCTGTGCCTGACGGCTTCTCCAAGACGGCCCACGTCCAGAGCATGGAGCAGTACGAGGCCATGTACAAGCGGTCGCTCGAAGATCCCGAAAGCTTC
TGGGGCGAGTTGGGCCGCGAAAATCTCGACTGGTTTCGTGAGTTTGACCAGGCCGTCGTCGGTACGGTGAACAAGGGCGACACGGCGTGGTTCCTTAACG
GAGAGACGAACGTGAGCGTCAACTGCATCGACCGTCACGTCAAGAAACACCCGAACAAGACGGCCATCATCTGGGAGGCGGACGAGATCGGCCAAGGCAG
GGAGATCTCGTACACCGAGCTGCTGGAGGAGACGTGTCGTATCGCCAACGCTATGAAGCACGCGGGCGTCCGTCGCGGCGACACTGTAGCCATCTACATG
CCCATGATCCCAGAGGTCGCGTTCGTTATGCTGGCTTGTACACGTATTGGCGCCGTGCACAGCGTCGTGTTCGCGGGTTTCTCGGCCGACGCATTGCGTG
ACCGCATAGTGGATGCCCAGACTCAGTGGGTATTCACGTCCGACGAGGGCAAACGTGGTGGTCGTACGCTACCGCTTAAGCAGATCGTGGACCACGCTGT
CAATGGTCTGGACTTCGTGCGTAAAGTGTTCGTGTTTAAGCGTACACACAACCCAGAGGTGAAGATGAACCCGAAGATTGACGTGGATATGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCTGGTGCCTGGCCTACCGAAGACGCGCAGTGGCAAGATCATGCGTCGTGTGCTGCGCAAGATTTCTCATGGCGAAGAGGACTCGTT
GGGCGACGTGTCGACCTTGGCAGATCCGTCTGTAGTGCCGACGTTGATCACGAACACGAAGGCTTCGCTTGCCGGCAAGACATTCTAAGGCTACGGAAGG
CAGAGGCACGTCGGCACTGATATTGCCGTCTTGATTAGCTCCGGGTCATGTCGTATTGTATTTTAGTACTGTCGATCATATATTTTTAAATCGATTCTAA
ACTTATTTGGTGCTTTTTCAGATTTGGCTTCACCAAACTGCAGAAAGGCGGCACTTCAACTTTCGACCATAGAAAAGTGTGTACCACATCACGTAGTGTA
CCGCACACGCCTGACGCTGGACTTTTGCGCCGTTTCCCACTCTATTTTCCCATTTGCGCTCAGTATACCTGGTGTGCTGGTCTCAAGCACATCAGTGGCT
GCATCATGTTGGCCTCGTCCAAGCGGTGTCGCGCGCCCAGCGACAGCGACGACTACCTCCCTGCTGCTCACAACTACCAATTGGCGCCCATGAAGGCGCT
TCTGCGCTCAGCCAGACGAGATTTCTGCCTAGACAGTCTACAAAACTCGTTCCCCATCAAGTCCGAAGAAGATTCAAAGCCCCAAGAATCAGCACTAAAA
CACGAGCAAGTGGGCAATAACTCAGACCAAGAGCTCAACCAAAAGTGCCGCATACTGGCCGAACTGATCGCTAATTCCCGACACCTGGTGGCCTTCACGG
GCGCCGGCATCAGCACGTCCGTGGGCATCCCAGACTACCGCGGAGAGCACGGTATCCGCACCAAGAACTTTAAGAAACGACAGAAAATCGACGAGGATAA
TGATGAGAGCAGTGATGCAGACGAAAGCGACGTTAAAATCGAGGAGAGCAAGCCTATAATCCCAGATTTTAACAAACTGGTGCCTTCCACGACGCACATG
GCACTCCATGAGCTCCATCGACTGGGCTACTTGAAGCACGTTGTTTCCCAAAATGTGGATAATTTGCACCTAAAAAGTGGCATACCGGCGAGTGCGTTGA
CGGAGGTGCACGGTAATGCCACTCACGCCAAGTGCGAGACTTGTGAGAAGATTTATACCAAGGACTTCCCGTGGACCGGGCTGTGTGACGACCCCGAGTG
CGTAAGTACAAAACGGCCAGTCGAGCAGAGACTGAGAGCTCGCACACGACACGGTAACGGCAGGTTGAAACGGAACGTCGTGGGTTTCGATGAGCCGCTG
GGGGATATTGACTTGGCTATCGACGAATGTGAGGCAGCCGATGTCGCGCTGGTACTGGGCACGTCTCTAAGAGTCGAACCGTTCTCGGAAATGGCTGGAG
ACTATGCAGGATCGCTGTGTATTGTCAACTTGCAGACGACAACATCGAAACTGGATCGTCGAGCGGAGGAAACGGGAGTTCGGCTGTTTGAGAAGACGGA
TGTGGTGATGGAGAAGATGATGCAGTATCTGATGAATGACCCTAGTTATCGTGTTCCCAAGTGGACTGGACAACATCCAACCTCTGTGTTTGAACCTGAG
CACGAGAGCAAGAACCTCGTCAACGTACTCGCTGGGCGTATGCTATCATGACAGACTTGCCTCGTCACCAAGCTGGTAATTTATATATCTTGCAGTTTTT
TTTTCCTAACGGGCAATAATTTTTTTGAAGAAACACGAGAATTCTATGCGTTAAAAAAACATTGACGATCTGATCTCTACGCCTCGTTCATGAGCGCCGT
AATTTCCTTGTAGTCTGCGATAAGAGCGTCTAGTTCTTCCGAGTATTTTGTAGTGACAATGACATCTTCCACAGGGGCAGACAAATCAGACGCCTTCTTC
AGACAAATCTTATACTGCGGGTACGAGCCGCCACAATACGCAATGTCTGCATACTCACAGAATGCGAGCATGGAGCCATCGCGACCGAGGATGTGCATGC
CGTAGCCGTTCACAGCGATGACAAAGTAATTAGGCAGTTCGATGCCCAGACAATAGTTGAGTCCGTTGCCAGAGCCCTTGGAGCCGCGGTTCACCAACTT
GGAAGGGAAGAAGCAGGCGCCGTACAATCTGTGGCGTGTTACCTCTTCAATGTAGATGCGTTGCAGCTCACTGACTGGGAACAAGGCGTCATGCTCGTCC
AGGAGGTTATCTGTGATGGTATCCAGCACCAATTCACTCCATTCTTCCTCGTCATGTGCTGGTCGCCACTCCTGAGGGAGATAATCCAACACACCCATCT
CTATGATCTCCTCTACCGTCAGAGGCGGCACATCTTCACAGTCCACAGCGATAGCGAGCGCCGTAAGGCGAAGCAGAGCCTCCTCTTCCAGTACAGGCAG
GTTTCCTTTCACGATCTCGTCCTGTACTTGGATATACACCAGCCGGTCGTACATTTCGTCCGTGTACTGCAGCATGTACACCGGGTTCAAACGGATCTTG
AGCACGAACCGTACGTCGCGTCCACGGATCAATTCCTTCTCGAAGATATCGCCGAGAAACACATCCGAACTCAAGAACGAAGGCGCTGCGATGAACTTGT
GGAAATAACTCGTTGGAGATGACGACGAAGTGGTCGATGATGTCGACGTACTGACTGTAAGGACTGGAGGAGGCGGGATCTCTTTGGTAGCTTCGTTGCC
ATCAGCCGCAGGGTCATCGCTCGCAGACACGAACGAAGTGGTCGTTGTAGTTGACTGGCCACTCTTACCGAGCACAACACGCTCGGATATTGTCGTGAGG
CCTAAGAAGTTGACGACATGGTCTTCAAGACCGAGGAAGTGCGAGCAGATCTCGATCAGTTGTGATACTGTGAGCTCTGGTGTGACCGGGAAGGCGTCGG
CCAACGGCGTGCCGTCTAGCAACTGGATCGTTGCAAGGAATGGCGGTCGTGCTTCGTAGCCACGAATCTCGTCAATGCTGGGGATAAAACCAGTGGCGCC
ATTCTCCAACAAGTTCTCCAGTTTTTTAAGCGAATAGGCCGCAAAGTTGCGTACAAGTCGCCAGAAGCTGTTGGAGTCAGCCACTTGAGCCTTCAGAAAC
ATGATCACGTACTTCTGGAGCGCTAGTGACGGTGGGAACGACGTCGCGCACATGGCAAACAACGACCAGCCGCGAATACTGCTGTCTCGCTTCGGATTCT
TCGTCAGTTGCTTCATAAGTTGCAGATAAATTTCGTCCACAAGAGAAGGCTTCATCAGTCCGATCTGAAGAATATACTGCGCCAGCATCTCGCGGTAAAA
GACTATGCGGTCTCTCATGTATCCCAGGATGCAGCGGTTAATAGACAGAGCCATTTGCCCAGCCGATGCAGACGTAGCGAGAGATGAAGTTTCGTCCGGA
TTGTCGTCAAGAACTGACAAACTCTGCGAGATCGCGCGACTCTCCCAGCATAATTTCTTCGCCAGAGCACGCTCGGATTGAGCGTTGAATCCCCTCAAGT
TCTCGAAATGATTGAACGCCACTGCATCCTTCTCGGCGCCGTGCTTGGATTTTTTGTCACTTGAACTGTCTGCACTATCCTCCTCGTTCGACACTCCAGG
CCACTCGGTTGTATCGCAACGTGGACGTTCACCTTCGTCCAGTACACTAGGTCGACTGCTGCTCTCGCTGTCGTTGCGAGTAAGCGTTCCCGGTCCACTC
GAGCGCAGTCGATCGCCTGTCACTACAGATCTCCGTCGAGCTGACACCATCTTATCTTCAGCCTTCATTAGCAGTCGTTCGTGAACACCAGCTTCTCTTG
CTGCTTGGATACTAAGCTCTAGCGCTCCAACAGACGACGCGTCAGTAGGGAGTGCCAGCGTTGATTCAAGACGAGCAGCAGCAGCGATACGAGCCTCTAA
CTTGCGACGCAAGTTGCCTGCATTAAGAAGGATCTGTTCCCGCTCTGCATCGTCGTATTTGGCTTCATTGTCACCACTTGAAGGGTTGGAGAACTCCTCG
ATTTCCGTGGACAGGAGCTGCACCGCGTCTTCTCGAATCTCGGCGTTGGCTTCCACCCGACGAGTCAACAGCTGAATGGCAGCATGGAGTCCGTCCATTA
TAGCAGCATCATCGGCTGCATCGTCGTTCGCTCCACCTCTCAGTTTCGAATAGCGGTCGAATAGCGGAGCAAATAGAGGAGAGCAGAACCCGATACTGAT
GGACTGTCCAAGTTCATGTTCCACGACTTTGGGATCGTCGGTATCAAGTGCTTGGCTTAGAGCTTCCTCGACACTCGCCACTTGTTGCAATCGCGCCATC
TTTGCATCGAATGCACCTTGTAACTGGGACGGAAGGGTAGAGCGTAGCTGGTCGAGATCAGTGACATGATGAGCCTCCCAGATCTGCAAGAACAGGCCGA
TAGGTGCAGGTTCTGAAGCTTTCTTCTCTTTCTTCACCTTCTTTATTGTCTTCACCTTCTTCATAACAATCCTCGTCTTGGTAGATGCTGGCTTTACTGC
AGAAACTGGAGCTGGAGGAGGACTTTCGCCTGATTCGGCAGCAGCCAGCAACTTTTCGCGTTCCCTTTCGGCGTTTTTAAGATTGAAATCCCACTTCGCT
AAGCCCACGCCGACAGCAGCTTCAATCGCTTCAGACAACAATTCAATATCTTGTGACATCTTAGCGACGGCTAGAAACTTCACCATTTGTTTGCGCTCAG
AATGTGCACTGGCAGGGACAGCTTGAGCCTCTAAAGCGCGTTCTGCATCTACTGTTCGAGGATCTCCATCAGGAACGCCAAGAGCTCTTAGTCGAACCAA
TACCCTCTCCACAGCGACAAAGTTCTCGTCATCTAGAGCCTTTTGAAGGGCAGCAACTAAGTTGGTCGTGTCAGCAGATCCAGCAGAAGAACTTGGGGTG
ATAACCTCTTCTTCAATCTCTTCTTCCACTTCCACCTCGACCTCTTCTTCAATTTCCTCTTCTTCCTCGTCCGTAACAGCCTCCACATCAGTAGGAATCG
TCCCCAGTGTGTCCACAAGTGTAGGCAATTTCGCTTCGACACCCAAGCTGATTGCCTTCGTTGCAGGACCCAGCAATTTATTCAGAATCGTAGCGTCATT
ATCATCTTCCTTGATCGACGAAAGAGCGTGTGTGACAGACTCCACGGCGCTTTTCTCCTCCAGTGCACGAATGATCATCATCGTCGCCAGTTTTCTCTCC
AATGACTCAACTGAGGGCTCCTCAAGTGTCGCCAAGGAGCCCATAAGCGCCTCCGGATCGTTAGCAATCATAGAAGCACGCAGCTTCTTGTTAACTGCAG
CGAGTTTCTCCGTCTTCTGCTTTTGCATCGCCACGATACTCTTGCTTTTTCTTCGCAAGTGGTCCACTGCAAGCCAGGGCGAACTCTTCTCCGCCACACG
TACAGCATACTCGATCAAGGCTGGATGGCCGATACGTGTGGCATCAGCAATGATCGAATTGACGTACTCTTCTTCATCCAAGCGTGCAATTAATTGCCGG
CCCTCGTTCAACACACGAATATCCTCTGAAGCGCGCTTCCCTAAGATCTGTTTACAGTTCGCAAGGTGCTGGATGATATCGTTCTGGTCTCTCTGTGCCA
TGGCTTCACGCAGACCGCGCATGACATACAACAACCGCGCAGACTTCTTACGAAACCCACCACGAAGCATATTGCGCTGGATCATAGTCGCACACGCGTT
CAAGTACAGGAATCGAGCCTTCTCCAGCTTTTTCCATTGGTGGCTGGTCAGATACACTTTAGTCTTCCCCACCACGAACTTCTCTTCTTCCAACACACCG
ATAGCAGACAGCGAACGCAGTAGAGACTCCAGCGTTCCTCGGTGACCACAGACGTTCTTATAGCGTCGGAAAAAGTGGCCGTACGTCAGATGGACAGTGA
AGATCGAGCGGCTGGCTTGCATGAGCTCTACCAGATGGTTCTCTCGGATCTGCTTCATCACGTAGGCCGAATCGAACACGCCTTCTTCCAGGTCTTCATT
GGGCTTGATACATACGAGAAAATTCTTTCCCGTGTGGTTCAAAGCATGCAGTAAAGCGTCAGCTTGGTTGTACACGTCAGTCGCTGCGCTGTCACTGGAT
GCCTTTGCCTCCTTTGCCGAGCTGATAGAACTCCGGAACTTGGAAGAAGTGCTTGTTCGACGAGTAGCTTGTTTAGCAGCTTTTTCACTGGACGCTGCAG
CCATTTGAGCAGCTCCCACAGCATGGAGAACAGCGTTCTTAGACGACTGCATGATAGCTGCACACGTTGAAGAGATACTCAGCGCGTTCTTAGCTGAAAG
GCCCTTGCCATTGTACGTAACCTTGCCGCAGTGGTGCTGAACAATGAACATCAGCCGCCAATCCTTGGACGGCGCCAAGTATTCGTTCGTCGTATCAGCG
CCCATATTCGGCCGCGACAATCCGCCAACAGCTTCGTTACCAGAGAACAGCTTGTTGACGAAATCCTCGTCATTAGGAGCGCGTATCTTGGCGTTTTCGG
TCAGTAGATCGAAGATACCGAAGGGCTTATCCTCGAATAACTGCAGACACTTTTCCTGTTCACTCGTAATGTCCACGTTAGAATGCACAGTCAGTCGGTT
CTCCACTTGTTGCGACTCGTCTTCCAGATCTGAGAAATTGATCGCTAATGTGTTCTGCACGTAGAAATGGTGCACTTTTTCACTCCAATAATTGAAACAA
AGCTGGTCAAAGCTGTTCTGTGACGGCTCCAGGTTTTCAAAGCCAACCATATCCAACACGTGGACGCCTTGTGAATTAATCACAATATTTGACTTCTCGT
AGCGATCAAAGATGCCGCCCAAAATGCCATTTAGCGTCTCCACGAGGAAGTTAAACAGCGACTCGTACAAACTCCGGATAAACGTGTCTCGTGCTTTACG
TGCTTGATTTACAGTCACCACTTTCAACGACGACACGGTCTTGCCGCCATCCTTTGAGAAAAACTGACGAGTGCGGAAGTAATTGTCCAAAACGACAGGC
TCCACCTCCAGAAGCTTCGCCGCAAGCAAGATCTGCGCTGGATCCTTCAATGCGCACGACTGAGCGTCGCTTACAGTCGTAGAGTTAGCGCCATTCACCG
ACTTGCCACCTTCCGGGTCCGGAACGAAATCCACATTGCCCAAATGCAGCAACGCAGCCACAATACGCACGATCTCGACACGCTGGTTCTTCCTGATCCT
CAAGGCTGAGAAGCTGGACATGAGGTCTCTGTAGTCTCGAGCATCCAGCGCAAAATTCGTAAGTTCCGGGTCTGCCTGCTTCAAAAGATCGAACTCCTCC
ACACCCTTGTTCATCTCCAGCGAATCACGAAGTGTAGGGTCATGCTGCACACCAGCGAGCACTTGATAAAACACGTGGAAGTTGCGTTCATGGCTGCGAC
AGTCGATTACGCGAGATTTCTCGAAATAATGGGTCGTAAAGCCGCCTCCGATCACGTAGCCATGTTTACTGAACTCCACCGAGATCATTTTAGCAAATCT
GGACGAGTTTGGGTTCTGTGTGGTAGCAGCGTTTCCAAATGCCTCCAGAATTGTAAAAGCATGTAAAATCTGCTGTCCAATGGGATGCAGCACGCCTGAT
TCTGCTTCTGAGTCGTGTCGAGGCGTAGCGCTGTCTCCGATCTCGCACAAATACTGTACAATAAGTTTGGCCGCTTCGGACTTCCCTGCGCCCATTCCTC
CAAGCAGAATAACAGCCTGATCCTCACCTGCATCTTGCATACATCTCAGAGCATTTTGAGCCAATGCAAACACGTGTGGCGGCGCGTCGTTCACTGTGTC
CTTCTCGTAGAGCGGCGTCTGCTCTCTGCTCTTATTGTAGGCCTGCATATGGTCCGGTGTGTATATAGGCAATGGGGTCACAGGGTTCACACCTACTAGG
ACGCGATCCACCCACGTGTAGACCTGCTCCATGCGATATCGTGCTCTTAAAGTGTAGAGCGCTACGTTCTCCAATTGTTGTGGCGTGAAAGTCTCTGTGC
GTCCAGCATCCCCATTGGTTGCCATTAAGGGCACATTACTGAGGTCGTGTAGCTCCAGAGGCAACAATTGCTTGGGGTGGTGGCAGGCTGGTAATTTGAC
CAATGGACGATCGCGGATAGCGCGCTCTTCGCCGTCCTCCGTGTGTACGACCGTCACGTGCTGCTCCTGGTCGGAATCCTCGTCGAACACGAAGCCCGTA
CGCACCACCACGGCGGACGTACAGATGCCGCTCTCGTCGCTTACCCAAACAAAGTCTCCTTCCTCGATGGATGCGGTCTTCTTGACACTGTGGCGCACCT
GACGCGACGGACGAGGGGACGCCTGGGAGGAGGATTGATCGCTACTGAGGCGGAAGCTCCCGGGACGCTGCTGCCCATTGCCGGCGCTGCGGTAGCTGCG
GCGCGGACCGCCTGCGTCCGAGCTCATTGCGGGTTACGCTTCGGAGACGGAGGCGATTTGCGAAGGTAGAGCAGGGGAAGGCGCGGTGCAATTATCCGGA
TGAAGGCACCGTTTCCGGATGAATTCGCCCTAATTTCAGCCGATTGGCTGAAATTAAGGTCTCTCTTATTTTATAGCACCAAGTGAAAGAGACTAAAAGG
AGTCGTTCAGCTCGAAAAAAAACCATTAAAGTTTTCGGGCTGAACACCATCCATCCCACTTGTGTGCTTTTCAAATGCCATGTAGTTTGCATGTTGTAAA
ATGAATCAACTAATCGGTTTGAAAAGGAATATGTCGTTTTAAAGGGGGTTGTGGTGTCGATAAAGTTCTCTCGGTGACATATAATAAGTTACCGCTAAAA
GTGAAATTTATTGTTGGGAACCACCCCTCGCGGCGACAATATCATTACGTTTTGTAGCTACAGAATCGCCAGTGTTGCACCACGGCGCTTATTAAGCTCG
CAATTCGTCTACAAATACAAAATACACTTCAATATGCAAATACATTCTGCTAAAAAGGTTTGAGATGCATGCACTTCCGCAACGATTGTTCGTAATGTAT
GAGTCAAATAGCCAATATCAGTATTTGCAAATGTACCCAAGACGCTTAACCATACATACATCAATGCTAGCATTTTGTATTGAATTGTTCTTGCCCCTTT
CGTGATGTCACGACATACAGCCAATAGCTTTGAGCTTGTGTCGCGTATATACTGTGTTAAAAGAGTTAAGGATACGAGCACCGTACCAGCCCTCATGATG
ACAACGCAAAACTATTATAGTAAGGAATAACATCTTTTAAGCGGAATAAGCGTATCACAAACTTATTTTTTACTCCCCATTGAACCTACTTGTGCGCTTT
CATCCTACTAGTAGGTCAGCTTATAATTAGTTCGCGAGCTTTCAACGATCTTTCATTGGCTGATAAAAAACGATTGGCAATTATAATCCTGATGACGTTA
AGCTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGGAAAGCCACACACCATCCAATTTTGGTGCGCTGCGCGTGTTCAAGATGCCAGCTCACTTTCCCTCTCCGTCTTGACAACAAACTCCGTATA
ATACTGCGCTCGACATCTCCGCAATACTCTAGCTTCTGTTGTATTTTCTTGTGTTGGCAGCCCCACCTAATTTTGTAACAAGTTTGCTGAAGCTCGAAAT
TCTATTAATAAGGACATACTCATACTAGTGTTGGCCATTGCTCATTTGCTTAGTCGGTGTTTTTCAAGTACATTTGGCTACGACTAACCGCCCTAAATAT
CCGCCTCGACTACTAACGATATTCTATTTAGCAAAGGAGCACAATATGAATTGCGCTCCGTTCTGAAATACAGTATTGCATTACAGCGACGGACATAATG
CAACTGCTATCAGCTAACTATCAGTCGAATCCCGAAACGAACAGAAAAGACAGTGCAGATCGTGAAGAACCAACCAATCAAAGCACAATACTACTCAATA
TTAACCAATCACAAGAACACCAACTCGTTAATTCCCAACCTCTCAGTCGGTAAAATGGAGGCAGCCACAACACCGAACGAGGAGGACGAAGTGCTTTTGC
ACGCAGAGCTAGCAGCCGTGGACACTCTGGTTGCCGCGATTAGCGGGAAGAAGCTCCGCAAGCGCTACAGCGTTAGGATGAAGCGAGAGGTACTGCAAGC
CACAGATGACATGAGTGAGCGCGAGGCTGCTCGCCCGCAAGGTATCCCGCGGTGGACTATATGCGACTGGCGAAAGAAGAAAGAGGAGATCTTCGCCTAC
GAAGGGAGCGAGAAGACGCTCTCGAGAGCGCCGGGCCGGCCCGAGAGCGTGCTGTTTGGGATGGAGCTGATCACTTACGTGGAGGACACCAGGTGTGACT
GTCTCCCGCTTACGGCACGCGCTATGACTGCTATTGTGCGCGATTGCTACTTCGTGTGGCTGCTACTGTACGTCAAAGACGAGAAAGATGCGAGCACTGC
ATACGAGTCTCTGTTTCGGCTGCTTCCGCGGTTCGTTTACCGCCACGGGATTGTGCAGCAAACAGCGGATATAAAGATGTTATTCAACTGTCACAATTGC
TCTACAACTGTATTTTACGCCACTAAAACCGACTATGTGCTCTTTATGTATATTAGAAAAAAATCGCTGCCATCCAACTAGCGTTCGTTGTCAAGTTAAA
CGAGAGTTTTGGTTCATATCCAGCGAGTGCTACCTACAATAATGACGATACCGGTATATATTATGACACTCCATCGTCAAAACCCTGTCGCCAAAAGGCA
AAGAAGCAAAGCTATCTGTTCAATAAAAGCACTCGACGAGAATGACGGCCATTTGCATCATATGCGGGGACGGTGTAAAATTACCGGCGATGTCGCGGAA
ATCCCGACACTGCAACCACTTGTACTACAAAAAGTACAAGTGTAACCCCGATAATGTCAGTGGAGATCTAAGCGGCAAGCCCAGACTCATCCCGGCATCG
TTTCGTTTGATGACTAAACTTACGAAATGGCTAAATCTACAGCAGTACGCTTTGCTGATGCTGACAGCAACGCGAGAGATGCATTACGCGGGAGACTTCA
GGACGATGGTGTATAGGGGGCAGACCTTTCCTTCTACGCATTGAGCGACATTGCGTTCTGTCCTGTCCTAGTCCGTCTGCATCGACTGCACAAGCCCGTA
CGAGTCATCGTCGACTTTAAGTGGGTAGACTGCCATCAGATGCCTGAAGCTAAGGATTGACGCTGGCATTCCCGTCCTGCATCGCAACTGCATGATGCAT
TAGAAGCTATTTGTTCTTATATACACGGACAATATGTTCGTCTCCACCGGTAGTGCAAATCTGACTACTGCGGCATGGGATCGCAACGATGAGCTTCTCG
TTCAAACCATGGGCCCTCCAGGTCAGTAGAGTTTGTTGTGTTTGATTTGCTTAAGATTATAATCGTGCTGACGTAATTTATCTTTATCTTTAACGTACCG
TATAACACGGATCCAATGCTACACTGGTAAAAAAAAAAAAGTTCATGTACAATATAAAATGCATAAATGGGCGTCCAGTTTTTACTCCTGTTAGAAGTCT
CTTGCACGGCGCACCAACAATTTCAGTTGCGCGCCAAAATGCCTTTCATCCTCCCACTTTTATTCTGGCAATGACACGAAGATAAAAAACAAAAATAGAA
GTAAGCTGGGTGGACTTCGCGCCCTTGAGGAGGCCTCCGTTGTCGCAGTAGCAGCTGATGCAAACGTGCACCGTACCACCATCTACTGGTGGAATCGACA
GAAGGATGACATTGTCAGTGCTTCTCCCTACAAGTATTACGTCGCTACAGGCAATCGACAAAAGCTCTCCGTAAAACACCCGGACCTCGAGAAAAGATAT
TTGTTAAAAACTAATCTGTGGCTAACTAAATCTTCAAAATAATTATTGATGTACCTACAGGTTATTAACCTGGATAACAGACATGAGAAAGAACCGCTCG
CTGTGTGTTCCCATGGAATGCCAGCTGCTGATGCACGCTCGGTTCAAGGGGGACCTCTTTGCAAGTCGATCGCGGCGTGCAAACATCGAGTATTTGCGGC
GATTTCTCAAGCGTAATCGACTTCCTATTAGGCGAATAACGCACCAAGGGCGCAAACGAAGATCCGACATGGAGGTAGTGGGGTAAAAATGATTTCGATT
TTATTATTGCTGATTAAACTTAATTAATATCGTTTTAGCTTGTTGCAGCAATATTTAAGGCACTCTATCCAGTACGACATTGAAGAGCGCGCGGGGGGGG
GGGGGGGGCTTTCTTTTAAAAGAGGCGTCCAAGTATGAAGCCGTCTTCAATAAGAAGCAGACAGGTATTAACATTGACATGAACGGCAAGACAACAATCG
ACTTTGTTGGATCTCCGACAGTGGACGTACCTCAAGGCACTTTGAGTTTCTTGCAATTTGTATTTACTTTTGTTTTAACGGTTTGTTAATGTTTAAGTAG
CGAAGTCGACGGATTTTGCTGCTCTGTGTTTTTGACTGCTTCGGAGACTCGATTGTACGATCAACATATCCGTGTGAACAATCGACAAGGCAAAACTACA
TGTCAGTGGCAATGTTATTGAATAAACGCAAAATAAGATTTTAAATTTTAAAGGCAAAATAAAATCATGTTTGATATTAAATAAAACTATTAATCACTAT
CCACTTCTAGAAATATGTTTAAACCGCTCTAGTTGTTTAAATCATCCCATCGGAACTTCACGAGAGCCTGGCAAAATCTGCCTGTATTGGTGTACAATAG
TGCCAGGGATAGTCAAAAACTATTATCTCAAATATTCCGATTTAACAATAAAATATTTAAATATTTTATTTTCTCCTTTTATGCACATAAAATATTATTA
TTAGACTAGGATGCTTCGCTTAGGCTGGGAGGACTGTGGAAGTGGCGTAAAAGTGTTTCGTGTAACTACCTTATGTGGGTGCAAATACTGCTTCGCATAT
ATTGTTCTGTTCTCAAGGATGCAAGTCATCTTAAACCAGAACTACTCTAGATTTTTATTTTCTCCGTTTTTTTTTTTTTGGGGGNNNNNNNNNNNNNNNN
NNN