Description :
From Genome Similarity Track
Location :
Scaffold_254:19522- 21750
Transcript NameFunction/comments
Hyaar_Emoy2813216hypothetical protein

Sequence
2228 bases(100 bases per row)
ATATCACTCTAGTACTGGCATACACAAGCATTTAAACACCTTATTTATCGCATGGAGGGATATAAAGAGATCGATGAAGTTATATATGGAGATATTAATT
GCGAAGTAGATCGACTTCAAATTCAAGATTAGTGAATATTCAAATGTGGTATTTTTTGTTGACGATCACGTCCAAGACCGCGTCCTTGCACAATCGGGAC
AGCATCCGGCTTCCGTACAACGTAGGTTTGACACAAAGCATTCCTAAAAAATTGCGGTAGTATAGGCAGATGCGTGATCTGATTTTTCTTGATTGTGCGT
GCCGTATCCATCAACAACAGACTAGTATACTGCCACATAAGTCTCATTGCTGGTATCAACCAGTATGGTCATCGCCATGATCGCTAGCCACTGAAATTAA
TTTTAAAGGTGACGGTAAATGGACAATAGTGACTGCGTGTCGAACTGCGACGCTTCCGCGACTCTTCCTCTAAATTAGTTCTGTCAGTTCTTTTCACTAT
CCAGCTTTAGCAGCAACCAGCCAAAAATTCCTTGTCTTGCCTCCCAGCAATTCTTCGAGCGACTTCTGAAAATGATTACTTATTATCAATCACATGAGCA
AGTATATCAGATCGTACAAACGTTTGGTATATCCGGTATGGTGTTTTGTTATTCACACATAAAGAGATCGATGAAACTGATAGGCGTATTATTGTACTCA
ATACGCAAAGCGGTAATACCGTACATTATCGATTACGGTTAGATGGTATCTATCGTAATAGGTATTCAGAGGGGCGGCGAAGTTGTGGTGTGGTACACCA
GAAGAACCTTTATGAGGACTATTCGATTAGGTAGCATAGTTTCAAGGGTAACGACGTAAATGAGGTTTATTATCGCTATAAATCAGTAAATACACTCAGT
TCCCCTCTTGATCAGTTTAAAATACGTGTCTTTCTAGACGTCTCTAGTCGTAAGAGTTAAGAGACAGCATTAGGGCTAGTACTCTTGGGCATTAGTGCCA
CGTGCTTCCTTGGAGTCGATATATCCTTGACCAAGAATAGAAGCTTACGAGCTTGTTCAGATACTTAAAGTTAAGTCACGAAGTCTGTGAAGGCTTGAGA
TCTCTTAAGTTAATACTCGTCTAGTTAATACACTAAGAGACTCTACGAGTCTATAAGTATTCCTCTGACAAAGAAGTAAGGGTAGCTCCGTTACAGTACT
GCATTGTTGAGTGATAAGTGTATGACCTTATGTCACCGTGCACGAAAAAGTTTATAATACACAGTCACGGTTCGACTCAATCGCTAGTATTCGTTAATCA
TATCACGGAATAGCAGTGACAGCACAATGTCAATGTAGCGTATGATAAGGTATACACGGATGTTGCAATAATCCCCTCACCAGAGCGCCAAGATTAAGCA
CATGGGCCGTTGTAGATATTCACTCGATCACAAGTCATTACCGGTGTGGTGGTACCCCGACTTGACTCAAAATACACCTAGGCTCTGCGAGATACTATTA
CTGTGATCGCTAACCTTTTCGAAAATATCGATCAACCCTTTTCAGGTTCGAACGTTCAAGTGCGGCTAATCACACACTGATCATAAAGCATCGCAATCTT
CACAGGAAATGAGCCTACGAAACAAGCAACGCTTCTGCCAAACAATAATGATTTGCCGCTCTACGGTGGAGAATCCAATATGCTAAGCTGTCATCCGCTC
CCATCAAGTACGGCTTTCTCATTAGATTGGTTCAAATAGAGGCTGCCCCATTCTATACGTGGCGAGGTTCCTGTGGAAGCATCCTACCGCATTTGACGGC
ACTCCTTACTATTAACCAAATGGATGCGAGCTGCGCAAACATCCCTGTGTATTTAGTACCAAAAGTACGACCCGTATACATGCGGTCTGTGGTTGTTATG
TATAGTTGACATCTACTACATTTCCCACCACTTTTTTCACATAACACGTTTAATTAGGCCGTATGTCTCTCATATCTACTCTTCATAGGTGTCTTCGTTG
TTGGAGAGTTTATGTTCCTTCTTGCTGCATGACCACTAGAAGATTGCGCCGTTTAGATGAGCGGCATGTTTATAAAAGACAGAAAAATTTATGAGGAGTG
GAGGAGTTGAGGATTTGGGGAGACTCGGGGGCGTGAGAGAATGGACGGGTGCACAAAGGAAACGTGTCACATTTTGAGCTTAGGACCTAGCGAGCAGGCC
TAAGCTATGTCCAGGGGTGTTTATTTCT