Description :
From Genome Similarity Track
Location :
contig_36:195134- 197170
Transcript NameFunction/comments
g7462.t1hypothetical protein

Sequence
2036 bases(100 bases per row)
TGTACCATGCGTACCAGATAGACCCAGTCCTTGTAACTGATCTTGTAGGTTAAGATCATCGTCCTCATCACTTGGAGGATGACGCGGTTGAAACGCTCGA
TGGATCCATTCACCAATGTGCTGTACGCAGGAGTGAACGTTTGCTGTGATCGCAGACGTCGGCTGAGCTCGGAGATGATTTCGTTCTTGAAGTGACTCCC
GTTGTCTGAGACCCATACGGGCGGTATCTCGAATCTTGAATGCCATACCAGTAGGGCATCAATCACCACGAGGCTGTCTGCTGTGTCGGCCACTACTAGC
TCGCAGTAACGAGTGGCATGGTCCTTCAACACGAGCAGGTACTTGCTGTTGCCGTAGCTCTCGCCCATGTACAAGTAGTCGAAGTGTAGGACACCATTAC
GCGTGCTGCACTCAATCACCTCACTCCACGGGCGGGGGACAACCTTCCCCCCTCACGAATGCAGACAGAGCAGACAGCCTTTGACGAAGCTGCCCACAAC
GTCCGCGATGTGGTTGATGGCGAAAAGTCGGCGTAAATGTGCAATCATTGCGGCTGGCCACGGCGACGTTGAGCACCACAATGGGCTACGATACAGAGGC
GCAGTAGAAGGGAACCGGCCTCAGTTGGTATCCACAAGCGGTTGTTGAGAACCACTAGACCATTCTCGTCCGTGTCTGCCCCAGCAGAGGTTGGGTGCGT
TGATTGTACTTCTCGGAGCTCTCGAAGCGTAGGCCAGATGAAATTGTCGTCGTCCAGCGGTCTCAAGGCTGAGACGGGCCTGGGTTCGGACGGTGAGAGG
CTTCGAACCGCCTTCAACCGCTTCACCGAGACGGATGGCGTATGGTTGCCGGTCCACCGGGAGATCATGTCGTCCACACTTTGTCGGGTGCTCCACCACG
TAGCGATAGTTTATTAATATCATCGCCCAACGTAACAGCTTCCCTCTCACGTTCTTCTTCACCGACTTGTCCGGTGCGAAGACATGGATGAGGTTACGAT
GGTCACAATACATGCGGAAACGCTTGGGCTGTAGAAGTAAGTAGTCCAGCTTGTCACACGCCACTGCAATGGGGAAAGCCTCCTTCTCGATGACAGTCCA
ATTCAGTTGGCTGCCAGTAAAGGTTCCGCTCATACAGAGTATCAGGCGGTGCTGCTGTTCTTCTTCGAGTCGAAGTCGATCACTTGCGTGACGATGATTG
CGTACCCGACGTCGGATACATCAGTGAACATACTGGTGTAATGGGTCTGCTTAGACCCACTACTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGT
AGGAGTAATTAACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTAAACCTAGACAAAGGACCGAACGAAGCTTTGGTGCAAATGAGAACTGTATTG
ATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGT
AGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATCCTTAGTGCATGTTGCACTAAG
GTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACCATCCCCCGTTAGGATTTGACGTGCCGGTCTCGACACGTCAATCCGTATTTTCTTCGGGAGAACA
CGTGCTCATTCCCAATGAGCACGCCAACGACGTCTTCGTCCAAGACGCCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTCCAAGGCGACGACGGC
CGCTGCCTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCGATGCCGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCTGGATACCACTCGAGA
TGGCATGAGAAACATGCCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGTATCTACTCTCCGGGTGGAGAGGGAGTTCCCCTCG
ACTACGGAAGCGAAGTCGAGGAGGGGGAACTCGAAG