Description :
From Genome Similarity Track
Location :
Scaffold_2:1950612- 1951696
Sequence
1084 bases(100 bases per row)
TCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCATGCGCTTCTCGGTTTTCCCGACGGCACCTGGTCACGATGTTCGAGACCAA
GTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGTGGGGGCTCAAAT
GCTTGTCTGAGGTTTTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGTCCATACGCCCAACTTCTTGCACGTCCGCCAAGAC
ATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCTGCCGACATAGTTGCTCACATTGAGCTTCAGCGATTGCGCGC
GTGGTGTCGTCCCGGACGGCACCGCGGTAGTAGCAGCAACATCGCGTTGCTCCTTTAGGATGAAACCCAGAGCAACACCGTGTTGCTCTGTCGGCGTTAG
CGTACGCAGCATCGTAGCTACCGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGGGCTTCCCACTCTGGATCCGACAGGTGGGGACAGTCAGCGCGT
GCAACGTGAGTTGCAGGCGTAGTGGAGCTTTCCATGGGCACCTCTGTATCCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTTAGG
TAGTCAGTCGTTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGG
AAGCGTAGGTTTCTTTTACTTGAGTTAAGTATGCTCGAGATCCACGAGTATACTTTAAACAAGATAAAGACTCCAAGTAGCGGGTTTTGGTAAAAGATGA
GAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAACTAGGAATCTGCCAACGGCTGGTTGGCAGGATTCTGCTAACATGCA
AGTCACTCATTGGCTAAAAGATGCTGGACCACCCGTCGTGGTGATCGTAAATGTATGTAGTCTTTGGTGTGTCTACACCAAGGT